Significance of 125I radioactive seed implantation on growth differentiation factor and programmed death receptor-1 during treatment of oral cancer

Table 1 Primer sequence

	R (5’-3’)	F (5’-3’)
GDF11	GTCATTAGCATGGCCCAGGA	GGCCTTCAGTACCTTTGTGAACATC
PD-1	GCACCGTCAAGGCTGAGAAC	CCGCTAGGAAAGACAATGGTG
GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGACGCCAGTGGA

PD-1: Programmed death receptor-1; GDF11: Growth differentiation factor 11.

Table 2 Comparison of general data in the two groups, n (%)

	Research group (n = 89)	Control group (n = 95)	χ2 or t	P value
Age (yr)			0.888	0.376
	49.2 ± 8.6	50.3 ± 8.2
BMI (kg/cm2)			0.963	0.337
	23.62 ± 3.52	24.16 ± 4.05
Disease course (mo)			0.174	0.862
	7.62 ± 4.16	7.51 ± 4.38
Gender			0.870	0.351
Male	62 (69.66)	60 (63.16)
Female	27 (30.34)	35 (36.84)
Smoking			0.095	0.758
Yes	60 (65.26)	62 (65.26)
No	29 (32.58)	33 (34.74)
Drinking			0.684	0.408
Yes	55 (61.80)	53 (55.79)
No	34 (38.20)	42 (44.21)
Preference for betel nut			0.284	0.594
Yes	65 (73.03)	66 (69.47)
No	24 (26.97)	29 (30.53)
Dietary preference			0.432	0.511
Spicy	52 (58.43)	60 (63.16)
Light	37 (41.57)	35 (36.84)
Exercise habits			0.382	0.537
Yes	12 (13.48)	10 (10.53)
No	77 (86.52)	85 (89.47)
Tissue type			0.486	0.975
Squamous cell carcinoma	38 (42.70)	38 (40.00)
Malignant lymphoma	16 (17.98)	15 (15.79)
Mucoepidermoid carcinoma	18 (20.22)	22 (23.16)
Adenoid cystic carcinoma	10 (11.24)	12 (12.63)
Adenocarcinoma	7(7.87)	8 (8.42)
Pathological staging			0.354	0.552
I-II	16 (17.98)	14 (14.74)
III-IV	73 (82.02)	81 (85.26)
Metastasis			0.000	0.991
Yes	75 (84.27)	80 (84.21)
No	14 (15.73)	15 (15.79)
Degree of differentiation			0.368	0.051
Poorly differentiated	79 (88.76)	80 (84.21)
Moderately and highly differentiated	10 (11.24)	15 (15.79)
Nationality			0.812	0.368
Han	85 (95.51)	89 (93.68)
Ethnic minorities	4 (4.49)	6 (6.32)
Living environment			0.367	0.545
Cities and towns	62 (69.66)	70 (73.68)
Countryside	27 (30.34)	25 (26.32)

Table 3 Comparison of efficacy between the two groups, n (%)

	Research group (n = 89)	Control group (n = 95)	χ2	P value
CR	33 (37.08)	20 (21.05)
PR	35 (39.33)	38 (40.00)
NC	15 (16.85)	22 (23.16)
PD	6 (6.74)	15 (15.79)
Cure rate (%)			5.017	0.025
	76.40	61.05

CR: The tumor focus completely disappeared and lasted for more than 4 wk; PR: The tumor focus was reduced by more than 50% and maintained for more than 4 wk, and no new lesions occurred; NC: The tumor volume was reduced by < 50%, increased by < 20% and maintained for more than 4 wk, and no new lesions were found; PD: The tumor focus increased by more than 20% and a new lesion appeared.

Table 4 Comparison of adverse reactions between the two groups, n (%)

	Research group (n = 89)	Control group (n = 95)	χ2	P value
Spinal cord injury	0 (0.00)	3 (3.16)
Laryngeal edema	1 (1.12)	7 (7.37)
Vascular embolism	0 (0.00)	4 (4.21)
Pain in operation area	0 (0.00)	9 (9.47)
Radiation skin injury (Total)	20 (26.97)	0 (0.00)
Degree 0	65 (73.03)	-
Degree I	14 (15.73)	-
Degree II	9 (10.11)	-
Degree III	1 (1.12)	-
Degree IV	0 (0.00)	-
Total incidence rate (%)			0.010	0.922
	23.60	24.21

Table 5 Comparison of recurrence between the two groups, n (%)

	Research group (n = 89)	Control group (n = 95)	χ2	P value
Recurrence			5.406	0.020
Yes	13 (13.48)	26 (27.37)
No	77 (86.52)	69 (72.63)

Table 6 Predictive value of growth differentiation factor 11 and programmed death receptor-1 for efficacy

	GDF11	PD-1	GDF11 + PD-1
AUC	0.704	0.729	0.848
Std. Error	0.040	0.039	0.028
95%CI	0.624-0.783	0.652-0.806	0.793-0.902
Cut-off	2.605	1.565	0.314
Sensitivity (%)	63.79	53.45	96.55
Specificity (%)	69.92	83.74	67.48
P	< 0.001	< 0.001	< 0.001

PD-1: Programmed death receptor-1; GDF11: Growth differentiation factor 11.

Table 7 Predictive value of growth differentiation factor 11 and programmed death receptor-1 for recurrence after treatment

	GDF11	PD-1	GDF11 + PD-1
AUC	0.772	0.750	0.881
Std. Error	0.040	0.045	0.036
95%CI	0.694-0.850	0.662-0836	0.810-0.952
Cut-off	1.655	1.125	0.310
Sensitivity (%)	92.46	61.54	82.05
Specificity (%)	46.48	77.46	88.73
P value	< 0.001	< 0.001	< 0.001

PD-1: Programmed death receptor-1; GDF11: Growth differentiation factor 11.