Correlation between TEX14 and ADAM17 expressions in colorectal cancer tissues of elderly patients and neoplasm staging, invasion, and metastasis

Table 1 Primer sequences for each gene

Gene	Forward	Reverse
TEX14	ATGTCGGACATCGGAGACTG	CTGGTCTCCAAGTCGAAAG
ADAM17	CTGGCTGGCTCATCACATTC	CATGCCTGTAATCCCAGCAC
β-actin	AGAGCCTCGCCTTTGCCGATCC	CTGGGCCTCGTCGCCCACATA

ADAM17: A disintegrin and metalloprotease 17; TEX14: Testis-expressed gene 14.

Table 2 Differences in TEX14 and ADAM17 mRNA profiles between colorectal cancer tissues and adjacent normal tissues

Group	n	TEX14 mRNA	ADAM17 mRNA
CRC tissues	86	1.61 ± 0.23	1.82 ± 0.29
Adjacent normal tissues	86	0.98 ± 0.13	1.00 ± 0.12
t value		22.114	24.230
P value		< 0.001	< 0.001

Data are mean ± standard deviation. ADAM17: A disintegrin and metalloprotease 17; CRC: Colorectal cancer; TEX14: Testis-expressed gene 14.

Table 3 TEX14 and ADAM17 protein profiles in colorectal cancer and adjacent normal tissues

Group	n	TEX14				ADAM17
		(-)	(+)	(++)	(+++)	(-)	(+)	(++)	(+++)
CRC tissues	86	25 (29.07)	20 (23.26)	29 (33.72)	12 (13.95)	19 (22.09)	31 (36.04)	27 (31.40)	9 (10.47)
Adjacent normal tissues	86	63 (73.26)	17 (19.76)	6 (6.98)	0 (0)	55 (63.95)	18 (20.93)	13 (15.12)	0 (0)
χ2 value		43.767				34.863
P value		< 0.001				< 0.001

Data are n (%). ADAM17: A disintegrin and metalloprotease 17; CRC: Colorectal cancer; TEX14: Testis-expressed gene 14.

Table 4 Association between the protein profile of TEX14 and clinical pathology

Pathological features		n	TEX14		χ2 value	P value
			Positive, n = 61	Negative, n = 25
Age	≥ 65 years	54	36 (66.67)	18 (33.33)	1.279	0.258
	< 65 years	32	25 (78.13)	7 (21.88)
Sex	Male	47	35 (74.47)	12 (25.53)	0.629	0.428
	Female	39	26 (66.67)	13 (33.33)
Pathological type	Tubular adenocarcinoma	33	23 (69.70)	10 (30.30)	0.715	0.699
	Villous adenocarcinoma	27	18 (66.67)	9 (33.33)
	Papillary carcinoma	26	20 (76.92)	6 (23.08)
Tumor diameter	≥ 3 cm	46	30 (65.22)	16 (34.78)	1.565	0.211
	< 3 cm	40	31 (77.50)	9 (22.50)
Differentiation degree	Low differentiation	27	15 (55.56)	12 (44.44)	6.602	0.037
	Moderate differentiation	25	17 (68.00)	8 (32.00)
	High differentiation	34	29 (85.29)	5 (14.71)
TNM staging	Stages I-II	37	21 (56.76)	16 (43.24)	6.327	0.012
	Stages III-IV	49	40 (81.63)	9 (18.37)
Lymph node metastasis	Presence	53	43 (83.13)	10 (18.87)	6.972	0.008
	Absence	33	18 (54.55)	15 (45.45)
Infiltration depth	T1 + T2	37	21 (56.76)	16 (43.24)	6.486	0.039
	T3	41	33 (80.49)	8 (19.51)
	T4	8	7 (87.50)	1 (12.5)
Distant metastasis	Presence	46	37 (80.43)	9 (19.57)	4.333	0.037
	Absence	40	24 (60.00)	16 (40.00)

Data are n (%). TEX14: Testis-expressed gene 14.

Table 5 Correlation between ADAM17 protein expression and clinical pathology

Pathological characteristic		n	ADAM17		χ2 value	P value
			Positive, n = 67	Negative, n = 19
Age	≥ 65 years	54	44 (81.48)	10 (18.52)	1.077	0.299
	< 65 years	32	23 (71.88)	9 (28.13)
Sex	Male	47	39 (82.98)	8 (17.02)	1.549	0.213
	Female	39	28 (71.79)	11 (28.21)
Pathological type	Tubular adenocarcinoma	33	27 (81.82)	6 (18.18)	1.308	0.520
	Villous adenocarcinoma	27	19 (70.37)	8 (29.63)
	Papillary carcinoma	26	21 (80.77)	5 (19.23)
Tumor diameter	≥ 3 cm	46	38 (82.61)	8 (17.39)	1.270	0.260
	< 3 cm	40	29 (72.50)	11 (27.50)
Differentiation degree	Low differentiation	27	20 (74.07)	7 (25.93)	10.079	0.006
	Moderate differentiation	25	15 (60.00)	10 (40.00)
	High differentiation	34	32 (94.12)	2 (5.88)
TNM staging	Stages I-II	37	24 (64.86)	13 (35.14)	6.418	0.011
	Stages III-IV	49	43 (87.76)	6 (12.24)
Lymph node metastasis	Presence	53	46 (86.79)	7 (13.21)	6.336	0.012
	Absence	33	21 (63.64)	12 (36.36)
Infiltration degree	T1 + T2	37	24 (64.86)	13 (35.14)	7.250	0.027
	T3	41	35 (85.37)	6 (14.63)
	T4	8	8 (100.00)	0 (0)
Distant metastasis	Presence	46	40 (86.96)	6 (13.04)	4.706	0.030
	Absence	40	27 (67.50)	13 (32.50)

Data are n (%). ADAM17: A disintegrin and metalloprotease 17.

Table 6 Binary variable assignment

Variable	Assignment	Outcomes
TNM staging	Stages I-II	0
	Stages III-III	1
Invasion	Infiltration depths T1 + T2	0
	Infiltration depths T3 + T4	1
Lymph node metastasis	Presence	1
	Absence	0
Distant metastasis	Presence	1
	Absence	0
TEX14	Positive	1
	Negative	0
ADAM17	Positive	1
	Negative	0

ADAM17: A disintegrin and metalloprotease 17; TEX14: Testis-expressed gene 14.

Table 7 Correlation between TEX14 and ADAM17 profiles and tumor staging, invasion, and metastasis

C	TEX14						ADAM17
	Β	SE	Wald	OR	95%CI	P value	β	SE	Wald	OR	95%CI	P value
TNM staging	1.207	0.518	5.429	3.343	1.211-9.228	0.020	1.602	0.595	7.249	4.963	1.546-15.930	0.007
Invasion	2.703	0.988	7.485	14.924	2.152-103.491	0.006	1.886	0.803	5.516	6.593	1.366-31.813	0.019
Lymph node metastasis	1.613	0.732	4.856	5.018	1.195-21.067	0.028	0.978	0.466	4.405	2.659	1.067-6.628	0.036
Distant metastasis	1.825	0.819	4.965	6.203	1.246-30.884	0.026	2.077	0.804	6.674	7.980	1.651-38.584	0.010

ADAM17: A disintegrin and metalloprotease 17; TEX14: Testis-expressed gene 14.