Clinical implications of forkhead box M1, cyclooxygenase-2, and glucose-regulated protein 78 in breast invasive ductal carcinoma

Table 1 Primer sequences

	Forward (5’-3’)	Reverse (5-3’)
FOXM1	CAGTCCGATTAGTCAGCTCCT	GTCATTTAGCTCCTTGTGCTG
COX-2	CCGGGTACAATCGCACTTAT	GGCGCTCAGCCATACAG
GRP78	GTTACAATCAAGGTAT	CATTCACATCTATCTCAA
β-actin	CTGATATAGCCGCGCTCG	CACTCGGTGCCGGATCATCA

FOXM1: Forkhead box M1; COX-2: Cyclooxygenase-2; GRP78: Glucose-regulated protein 78.

Table 2 Comparison of baseline clinical data

	Control group (n = 70)	Research group (n = 65)	t/χ2	P value
Age (yr)	60.37 ± 5.25	60.26 ± 7.26	0.101	0.920
Family history of BC			0.457	0.499
Yes	8 (11.43)	10 (15.38)
No	62 (88.57)	55 (84.62)
Long-term smoking			0.099	0.753
Yes	20 (28.57)	17 (26.15)
No	50 (71.43)	48 (73.85)
Long-term drinking			0.182	0.669
Yes	12 (17.14)	13 (20.00)
No	58 (82.86)	52 (80.00)
History of breast disease			0.223	0.637
Yes	20 (28.57)	21 (32.31)
No	50 (71.43)	44 (67.69)

BC: Breast cancer.

Table 3 Correlation of forkhead box M1, cyclooxygenase-2, and glucose-regulated protein 78 with clinicopathological features of breast infiltrating ductal carcinoma

	n	FOXM1	COX-2	GRP78
Age (yr)
≤ 60	33	4.51 ± 0.69	3.22 ± 0.61	3.85 ± 0.71
> 60	32	4.75 ± 0.83	3.60 ± 0.87	3.12 ± 0.69
Family history of BC
Yes	10	4.66 ± 0.61	3.42 ± 0.65	3.05 ± 0.64
No	55	4.43 ± 1.37	3.31 ± 1.28	2.62 ± 0.95
Long-term smoking
Yes	17	4.65 ± 0.49	3.59 ± 0.54	2.96 ± 0.49
No	48	4.62 ± 0.84	3.34 ± 0.83	2.99 ± 0.77
Long-term drinking
Yes	13	4.36 ± 0.80	3.36 ± 0.91	2.81 ± 0.58
No	52	4.69 ± 0.75	3.41 ± 0.74	3.03 ± 0.73
History of breast disease
Yes	21	4.49 ± 0.63	3.42 ± 0.61	2.77 ± 0.59
No	44	4.69 ± 0.82	3.40 ± 0.84	3.08 ± 0.74
Histological grade
Grade I	35	4.39 ± 0.76	3.21 ± 0.72	2.75 ± 0.66
Grade II	19	4.57 ± 0.47	3.29 ± 0.61	2.91 ± 0.49
Grade III	11	5.48 ± 0.611,2	4.22 ± 0.701,2	3.83 ± 0.521,2
Tumor metastasis
Yes	21	5.03 ± 0.75	3.7 ± 0.78	3.41 ± 0.69
No	44	4.43 ± 0.703	3.24 ± 0.713	2.78 ± 0.623

¹Indicates a statistically significant difference from grade I patients.

²Indicates a statistically significant difference from grade II patients.

³Indicates a statistically significant difference from metastatic patients.

FOXM1: Forkhead box M1; COX-2: Cyclooxygenase-2; GRP78: Glucose-regulated protein 78; BC: Breast cancer.

Table 4 Univariate analysis of prognostic mortality in breast infiltrating ductal carcinoma

	Surviving patients (n = 53)	Dead patients (n = 12)	t/χ2	P value
Age (yr)			9.849	0.002b
≤ 60	31 (58.49)	1 (8.33)
> 60	22 (41.51)	11 (91.67)
Family disease history of BC			0.562	0.453
Yes	9 (16.98)	1 (8.33)
No	44 (83.02)	11 (91.67)
Long-term smoking			0.686	0.408
Yes	15 (28.30)	12 (16.67)
No	38 (71.70)	10 (83.33)
Long-term drinking			0.102	0.749
Yes	11 (20.75)	12 (16.67)
No	42 (79.25)	10 (83.33)
History of breast disease			1.646	0.200
Yes	19 (35.85)	12 (16.67)
No	34 (64.15)	10 (83.33)
Histological grade			37.350	< 0.001b
Grade I	35 (66.04)	0 (0.0)
Grade II	16 (30.19)	3 (25.00)
Grade III	2 (3.77)	9 (75.00)
Tumor metastasis			30.840	< 0.001b
Yes	9 (16.98)	12 (100.0)
No	44 (83.02)	0 (0.0)
FOXM1	4.49 ± 0.69	5.22 ± 0.80	3.214	0.002b
COX-2	3.28 ± 0.70	3.96 ± 0.84	2.928	0.005b
GRP78	2.83 ± 0.62	3.66 ± 0.66	4.140	< 0.001b

^bP <0.01 vs surviving patients.

FOXM1: Forkhead box M1; COX-2: Cyclooxygenase-2; GRP78: Glucose-regulated protein 78; BC: Breast cancer.

Table 5 Multivariate analysis of prognostic mortality in breast infiltrating ductal carcinoma

	β	S.E.	Wald χ2	P value	OR	95%CI
Age (yr)	-0.426	2.623	3.621	0.527	1.642	0.842-3.513
Histological grade	1.124	0.342	10.624	< 0.001	3.068	1.512-6.084
Tumor metastasis	1.824	0.493	20.184	< 0.001	6.521	2.164-14.813
FOXM1	1.109	0.384	8.147	0.004	3.024	1.541-6.038
COX-2	0.674	0.281	5.264	0.021	1.871	1.064-3.257
GRP78	1.084	0.573	11.806	< 0.001	1.583	0.962-4.823

FOXM1: Forkhead box M1; COX-2: Cyclooxygenase-2; GRP78: Glucose-regulated protein 78; OR: Odds ratio; CI: Confidence interval.