Sm-like 5 knockdown inhibits proliferation and promotes apoptosis of colon cancer cells by upregulating p53, CDKN1A and TNFRSF10B

Abstract

BACKGROUND

The role of Sm-like 5 (LSM5) in colon cancer has not been determined. In this study, we investigated the role of LSM5 in progression of colon cancer and the potential underlying mechanism involved.

AIM

To determine the role of LSM5 in the progression of colon cancer and the potential underlying mechanism involved.

METHODS

The Gene Expression Profiling Interactive Analysis database and the Human Protein Atlas website were used for LSM5 expression analysis and prognosis analysis. Real-time quantitative polymerase chain reaction and Western blotting were utilized to detect the expression of mRNAs and proteins. A lentivirus targeting LSM5 was constructed and transfected into colon cancer cells to silence LSM5 expression. Proliferation and apoptosis assays were also conducted to evaluate the growth of the colon cancer cells. Human GeneChip assay and bioinformatics analysis were performed to identify the potential underlying mechanism of LSM5 in colon cancer.

RESULTS

LSM5 was highly expressed in tumor tissue and colon cancer cells. A high expression level of LSM5 was related to poor prognosis in patients with colon cancer. Knockdown of LSM5 suppressed proliferation and promoted apoptosis in colon cancer cells. Silencing of LSM5 also facilitates the expression of p53, cyclin-dependent kinase inhibitor 1A (CDKN1A) and tumor necrosis factor receptor superfamily 10B (TNFRSF10B). The inhibitory effect of LSM5 knockdown on the growth of colon cancer cells was associated with the upregulation of p53, CDKN1A and TNFRSF10B.

CONCLUSION

LSM5 knockdown inhibited the proliferation and facilitated the apoptosis of colon cancer cells by upregulating p53, CDKN1A and TNFRSF10B.

Key Words: Sm-like 5; Colon cancer; Proliferation; Apoptosis; Knockdown

Core Tip: Sm-like 5 (LSM5) was highly expressed in tumor tissue and cells of colon cancer. Our study indicated that knockdown of LSM5 had an anti-tumor effect in colon cancer by up-regulating p53, cyclin-dependent kinase inhibitor 1A and tumor necrosis factor receptor superfamily 10B, which providing an important insight on the role of LSM5 in colon cancer development.

INTRODUCTION

Colon cancer is one of the commonest malignancies in the worldwide, and ranks fifth among all tumors in morbidity and mortality[1]. Although the 5-year survival rate of patients with colon cancer has significantly improved since the 1970s[2], the survival of patients with advanced and recurrent colon cancer has still been unsatisfactory. Thus, finding new therapeutic targets and possible treatment strategies is still an urgent need.

The Sm-like (LSM) family has been found in variety of organisms. Studies have shown that LSM proteins can form stable heteromers in tri-snRNP particles and are involved in the splicing and degradation of cytoplasmic mRNA[3]. For example, the nuclear LSM2-LSM8 complex can bind to U6 snRNA and participate in pre-mRNA splicing[4,5]. The cytoplasmic LSM1-LSM7 complex contributes to mRNA degradation[6]. Notably, LSM family members have been reported to be overexpressed in various tumors and to play a role in tumorigenesis. Bioinformatic analysis suggested that LSM family members are overexpressed in hepatocellular carcinoma[7] and gastric cancer[8], and are closely related to poor prognosis. In pancreatic cancer, LSM1 was reported to be overexpressed in tumor tissue and its overexpression contributed to the proliferation and metastasis of tumor cells[9,10]. Moreover, LSM1 was overexpressed in breast cancer cells and was associated with the proliferation and colony formation of breast cancer cells[11]. The overexpression of LSM2 promotes the malignant characteristics and poor prognosis of cutaneous melanoma[12,13]. Similarly, the overexpression of LSM12 promoted the malignancy of oral squamous cell carcinoma[14]. In colon adenocarcinoma, LSM5 is regarded as a downstream molecule of chromobox homologue 3, which is related to tumor metastasis, indicating that LSM5 may be linked to colon cancer metastasis[15]. According to the Human Protein Atlas (https://www.proteinatlas.org/), the 5-year survival of colon cancer patients with high LSM5 expression was 43%, while the 5-year survival of patients with low LSM5 expression was 69%[16], indicating that LSM5 may play a role in the development of colon cancer. However, the role of LSM5 in colon cancer has still been uncovered and reported.

Therefore, the objective of this research is to determine the effect of LSM5 in the progression of colon cancer and the underlying mechanism involved.

MATERIALS AND METHODS

Antibodies

The following antibodies were used in this study: Anti-LSM5 (Abcam, ab151717, 1:500), anti-GAPDH (Santa-Cruz, sc-32233, 1:2000), anti-rabbit IgG (Santa-Cruz, sc-2004, 1:2000), anti-mouse IgG (Santa-Cruz, sc-2005, 1:2000), anti-p53(CST, #2527, 1:1000), anti-IRF1(Abcam, ab186384, 1:1000), anti-cyclin-dependent kinase inhibitor 1A (CDKN1A) (CST, #2947, 1:500), anti-tumor necrosis factor receptor superfamily 10B (TNFRSF10B) (Abcam, ab8416, 1:250) and anti-MDM2(Abcam, ab38618, 1:500).

Cell culture

Human colon cell lines (HT-29, HCT-116, RKO and SW480) (obtained from the Cell Bank of the Chinese Academy of Sciences) were cultured in the corresponding media supplemented with 10% Fetal Bovine Serum (Ausbian, A11-102) at 37 °C with 5% CO₂. The culture medium was changed according to the degree of cell growth.

LSM5 expression analysis and survival analysis with the Gene Expression Profiling Interactive Analysis database and the Human Protein Atlas website

The different expression level of LSM5 in colon cancer tissue and the adjacent normal tissue was investigated via the Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/index.html).

Immunohistochemical staining images of LSM5 in tumor tissue and adjacent normal tissue from patients with colon cancer were obtained from the Human Protein Atlas website. The differences in survival among patients with different levels of LSM5 expression in colon cancer were analyzed via the Human Protein Atlas website. The results of the prognostic analysis were analyzed via Kaplan-Meier curves.

Quantitative real-time quantitative polymerase chain reaction

The real-time analysis has been previously reported[17]. Briefly, TRIzol reagent (Shanghai Pufei Biotech Co., Ltd, 3101-100) was used to obtain total RNA from colon cancer cells. The cDNA was reverse transcribed via an M-MLV kit according to the manufacturer’s instructions (Promega, M1705). Then, real-time quantitative polymerase chain reaction (RT–qPCR) was used to quantify the expression of RNA. The sequences of primers were shown in Table 1. The expression level of relative genes were computed by the 2^-ΔΔCt method[18].

Table 1 The primer sequences used for real-time quantitative polymerase chain reaction.

Genes	Upstream	Downstream	Size (bp)
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA	121
LSM5	CTAACGCTACTACCAACCCGT	TCCTTCTCCTCCAGGAACCAG	257
CDK1	GGATGTGCTTATGCAGGATTCC	CATGTACTGACCAGGAGGGATAG	100
MDM2	GAATCATCGGACTCAGGTACATC	TCTGTCTCACTAATTGCTCTCCT	167
CCNE2	GGAACCACAGATGAGGTCCAT	CCATCAGTGACGTAAGCAAACT	237
RALB	TCATCAGGAAAGGAGCACT	GAGGGGATACAGGATTGTT	189
CDKN1A	CTGTCACTGTCTTGTACCCTTGT	AAATCTGTCATGCTGGTCTGC	113
TNFRSF10B	GCAGACTTGGTGCCCTTTG	CCCACTTTATCAGCATCGTGT	133
AKT2	GCGGAAGGAAGTCATCATTG	GTGGGTCTGGAAGGCATAC	118
TP53	CCTCCTCAGCATCTTATCC	ACAAACACGCACCTCAAA	258
IRF1	GATGCTTCCACCTCTCACC	TGCTCCACCTCCAAGTCC	201

LSM5: Sm-like 5; CDKN1A: Cyclin-dependent kinase inhibitor 1A; TNFRSF10B: Tumor necrosis factor receptor superfamily 10B.

Western blotting

The cells were lysed by RIPA lysis buffer (Beyotime, P0013B/). The lysates were washed with PBS and centrifuged. The abundance of proteins were detected by the BCA Protein Assay Kit (Beyotime, P0010S). The samples were separated via SDS-PAGE and transferred to PVDF membranes (Millipore, IPVH00010). After that, the antibodies were added to incubate the membranes. The protein bands were detected via the ECL-PLUS/Kit (Thermo, M3121)[19].

MTT assay and Celigo cell counting

The cells were seeded into 96-well plates (2000 cells/well). MTT and Celigo cell counting assays were subsequently performed according to published protocols[20].

Colony formation assay

The cells were seeded into 6-well plates (800 cells/well) and cultured for 11 d and then washed with PBS. Then, 4% paraformaldehyde (1 mL) was used to fix the cells for 30 min-60 min. After that, Giemsa dye (500 µL) was used to stain the cells for 10 min-20 min. ddH₂O was used to wash the cells several times, after which the cells were allowed to dry at 24 °C. Then, a microscope was used to scan the cell colonies[18,19].

Apoptosis assay

An apoptosis detection kit (eBioscience, 88-8007) was used in this study. The digested cells were centrifuged and fixed with 70% ethanol. Flow cytometry was used to identify apoptotic cells after those were dyed with annexin-V-APC[21].

Construction of lentivirus and cell transfection

The template was set by target gene and assessed by design software (http://tools.genome-engineering.org) to find the interference target sequence of LSM5 which was 5’-TGGTACTCTTCTAGGATTT-3’. The sequence of the negative control was 5’-TTCTCCGAACGTGTCACGT-3’. Then, lentiviral construction and cell transfection were conducted according to a published protocol[18,20].

Human GeneChip assay

The Human GeneChip assay was performed with the 3’ IVT Plus Kit (Affymetrix, 901838). The double-stranded cDNA of the target gene was transcribed to synthesize cRNA. The cRNAs were purified, quantified and labelled. Pre hybridization mix was added, and the samples were reacted with the GeneChip. Then, Hybridization Master Mix was mixed with the labelled cRNA, and the mixture was added and reacted with the GeneChip. A GeneChip Scanner and software were used to scan and analyze the GeneChip, respectively. The raw data were filtered and standardized for further bioinformatic analysis. Then, Ingenuity Pathway Analysis (IPA) based on differentially expressed genes (DEGs) was performed. IPA software was used for bioinformatic analysis[22] and to find the potential targets after LSM5 knockdown.

Statistical analysis

GraphPad Prism 8.3.0 was used to analyze the data. The data are expressed as the mean ± SD. T tests and two-way repeated-measures ANOVA were performed to compare the difference between the two groups. A P value < 0.05 indicated that the difference was statistically significant.

RESULTS

LSM5 was highly expressed in tumor tissues and closely related to poor prognosis in patients with colon cancer

First, we used the GEPIA website to confirm the difference in LSM5 expression between tumor tissue and normal tissue from patients with colon cancer. We found that LSM5 expression was greater in tumor tissue than in paired normal tissue (Figure 1A). Immunohistochemistry of LSM5 from the Human Protein Atlas database also confirmed high expression of LSM5 in tumor tissue (Figure 1B). Further prognostic analysis revealed that higher LSM5 expression was strongly related to poor survival in patients with colon cancer (Figure 1C).

Figure 1 The expression of Sm-like 5 in colon cancer and its relationship with prognosis. A: The expression level of Sm-like 5 (LSM5) in colon tumor tissue and paired normal tissue according to the Gene Expression Profiling Interactive Analysis website; B: Immunohistochemistry analysis of LSM5 according to the Human Protein Atlas database; C: The prognostic analysis of LSM5 expression in patients with colon cancer. COAD: Chronic obstructive air way disease.

LSM5 knockdown suppressed the proliferation of colon cancer cells

To explore the role of LSM5 in colon cancer, we confirmed that LSM5 was highly expressed in 4 colon cancer cell lines (Figure 2A). Then, we constructed a lentivirus to downregulate the expression level of LSM5, and selected the RKO and HCT-116 cell lines for further experiments. After transfection of the targeted lentivirus, the expression of LSM5 in colon cancer cells was significantly downregulated (Figure 2B-E).

Figure 2 The expression level of Sm-like 5 decreased after knockdown. A: High expression of Sm-like 5 (LSM5) in 4 colon cancer cell lines confirmed by real-time quantitative polymerase chain reaction (RT-qPCR); B-E: LSM5 expression decreased significantly after knockdown, as confirmed by RT-qPCR (B and C) and Western blotting (D and E). LSM5: Sm-like 5.

The impact of LSM5 on the growth of colon cancer was further investigated. Cell counting and MTT assays showed that knockdown of LSM5 inhibited the proliferation of colon cancer cells (Figure 3A-D). LSM5 knockdown also restrained the colony-forming ability of colon cancer cells (Figure 3E and F).

Figure 3 Knockdown of Sm-like 5 inhibited the proliferation of colon cancer cells. A and B: Cell counting assay; C and D: MTT assay; E and F: Colony-forming assay. LSM5: Sm-like 5.

Thus, downregulating the expression of LSM5 could significantly inhibit the proliferation of colon cancer cells.

LSM5 knockdown facilitates the apoptosis of colon cancer cells

We further detected the impact of LSM5 on the apoptosis of colon cancer cells by using flow cytometry. The results indicated that reducing LSM5 expression promoted the apoptosis of LSM5 cells (Figure 4).

Figure 4 Knockdown of Sm-like 5 improved the prognosis of colon cancer cells. A and B: Flow cytometry. LSM5: Sm-like 5.

LSM5 knockdown restrained the growth of colon cancer cells by upregulating p53, CDKN1A and TNFRSF10B

To investigate the possible mechanism by which LSM5 knockdown inhibited the growth of colon cancer cells, RKO cells were transfected with lentivirus targeting LSM5, and a GeneChip assay was conducted. The quality of the raw microarray data was evaluated, and the results suggested that the data met the criteria for further analysis (Table 2 and Supplementary Figure 1). Then, bioinformatics analysis of the filtered data was performed. Differential gene expression analysis revealed that 757 genes were upregulated and 1318 genes were downregulated following LSM5 knockdown (Figure 5). The results of the classical pathway analysis of the DEGs are shown in the top 15 signalling pathways in Figure 6A. As shown in Figure 6A, “Colanic Acid Building Blocks Biosynthesis” was significantly restrained, while “p53 Signalling” was activated. In addition, Figure 6B shows the 15 diseases and functions associated with the DEGs according to disease and functional analysis. DEGs were enriched mainly in “cancer” (Figure 6B). Finally, we analyzed the interaction network of these DEGs, and the interactions between DEGs after LSM5 knockdown are shown in Figure 6C.

Figure 5 Microarray assay and differentially expressed genes analysis after Sm-like 5 knockdown. Scatter plot, volcano plot and hierarchical clustering analysis showing 757 upregulated genes and 1318 downregulated genes following Sm-like 5 knockdown. A: Scatter plot; B: Volcano plot; C: Hierarchical clustering analysis. DEG: differentially expressed gene; LSM5: Sm-like 5.

Figure 6 Ingenuity pathway analysis of differentially expressed gene after Sm-like 5 knockdown. A: Classical pathway analysis showing the 15 signalling pathways associated with the differentially expressed gene (DEGs); B: Disease and functional analysis showed the top 15 diseases and functions enriched by DEGs; C: Interaction network analysis showing the interactions between DEGs after Sm-like 5 knockdown.

Table 2 RNA quality inspection results.

Group	Sample name	Thermo NanoDrop 2000		2100 Result		Quality inspection results
		Concentration (ng/μL)	A260/A280	RIN	28S/18S
ShCtrl	6849-1	663.7	1.98	10	2.1	Qualified
	6849-2	663.7	1.98	10	2.5	Qualified
	6849-3	663.7	1.98	10	2.2	Qualified
ShLSM5	6850-1	418.1	1.91	9.7	1.2	Qualified
	6850-2	418.1	1.91	9.8	1.1	Qualified
	6850-3	418.1	1.91	9.5	1.2	Qualified

LSM5: Sm-like 5.

RT–qPCR showed that the expression levels of MDM2, CDKN1A, TNFRSF10B, TP53 and IRF1 were significantly increased following LSM5 knockdown (Figure 7A). Further Western blotting confirmed that LSM5 knockdown caused the upregulation of p53, CDKN1A and TNFRSF10B (Figure 7B and C).

Figure 7 Knockdown of Sm-like 5 promoted the expression of p53, cyclin-dependent kinase inhibitor 1A and tumor necrosis factor receptor superfamily 10B. A: Real-time quantitative polymerase chain reaction showed that the expression of several downstream molecules changed following Sm-like 5 (LSM5) knockdown; B and C: Western blotting showed that the expression of P53, cyclin-dependent kinase inhibitor 1A and MDM2 was upregulated after LSM5 knockdown. LSM5: Sm-like 5.

DISCUSSION

Although the survival rate of patients with colorectal cancer has significantly improved in the past five decades[2], identifying new available therapeutic targets for patients with advanced metastasis or recurrence is still warranted. On the Human Atlas website, we found that colon cancer patients with low LSM5 expression had a greater survival rate than patients with high LSM5 expression (69% vs 43%), suggesting that LSM5 may play a role in the occurrence and development of colon cancer. Therefore, in this research, we conducted experiments to explore the effect of LSM5 on colon cancer.

Indeed, scientists have focused mainly on the role of the LSM family in the splicing and degradation of cytoplasmic mRNA[3-6]. Only a few studies have reported the expression level and role of LSM family members in tumors[7-14]. For example, LSM1 was usually over expressed in tumor tissues and cells, and it was closely associated with tumor growth[7,9-11]. Similarly, we found that LSM5 was highly expressed in colon cancer tissues and cells. Colon cancer patients with high LSM5 expression also had a lower survival rate, indicating the adverse effect of LSM5 on tumor development. Therefore, we knocked down LSM5 to determine whether targeting LSM5 affects the growth of colon cancer cells. As expected, we found that LSM5 knockdown inhibited the proliferation and colony formation ability of colon cancer cells and promoted cell apoptosis, revealing that targeting LSM5 could have an antitumor effect on colon cancer.

We further explored the possible mechanism by which targeting LSM5 inhibits colon cancer. A human GeneChip assay was also conducted, and bioinformatics analysis was subsequently performed to identify the downstream molecules of LSM5. The results showed that the DEGs between the control group and the LSM5 knockdown group were related to “p53 signalling” and “cancers”. In addition, RT-qPCR and Western blotting of the genes among these DEGs confirmed that the expression levels of p53, CDKN1A and TNFRSF10B were significantly upregulated following LSM5 knockdown. TP53 is a tumor suppressor gene whose inactivation drives invasion, proliferation, and cell survival, thereby facilitating cancer progression and metastasis[23]. High expression of the TP53 gene and p53 protein can significantly inhibit the occurrence and development of colon cancer[24]. In addition, CDKN1A encodes a potent cyclin-dependent kinase inhibitor such as p21[25]. p21 functions as a tumor suppressor in several cancers by targeting p53[26]. It has been reported that suppression of p21 expression can promote the growth of colorectal cancer[27]. Moreover, TNFRSF10B encodes a member of tumor necrosis factor receptor superfamily, which is related to apoptosis regulated by TP53[28]. Therefore, on the basis of the findings of previous studies and our results, we believe that LSM5 knockdown can inhibit the growth and improve the apoptosis of colon cancer cells by upregulating p53, CDKN1A and TNFRSF10B.

This study has several limitations. First, we explored the role of LSM5 in only colon cancer at the cellular level. No experiments have been carried out on animals. Second, we did not further investigate the interaction between p53, CDKN1A and TNFRSF10B in colon cancer. Therefore, in the next step, we explored the potential mechanism of the LSM5-p53-CDKN1A/TNFRSF10B axis in colon cancer.

CONCLUSION

Our study indicated that knockdown of LSM5 has an antitumor effect on colon cancer by upregulating p53, CDKN1A and TNFRSF10B, which provides important insight into the role of LSM5 in colon cancer development.