RPLP0/TBP are the most stable reference genes for human dental pulp stem cells under osteogenic differentiation

doi:10.4252/wjsc.v16.i6.656

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 16, Issue 6

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (632)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-4) series, Tables (1-6) series.

Item

Count

PDF

HTML

452

Figures (1-4)

Tables (1-6)

Sum=568

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

Download

Sum=49

Jun 26, 2024 (publication date) through Jul 21, 2024

Times Cited of This Article

Times Cited (0)

Journal Information of This Article

Publication Name

World Journal of Stem Cells

ISSN

1948-0210

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

World J Stem Cells. Jun 26, 2024; 16(6): 656-669
Published online Jun 26, 2024. doi: 10.4252/wjsc.v16.i6.656

Table 1 Candidate reference genes for quantitative real-time polymerase chain reaction

Gene symbol	Function	NCBI access	Primers sequences (5’-3’)	Temperature (°C)
RPLP0	Component of the 60S subunit	NM_001002	F: AGCCCAGAACACTGGTCTC	60
RPLP0	Component of the 60S subunit	NM_001002	R: ACTCAGGATTTCAATGGTGCC	60
TBP	Transcription, metabolic pathways	NM_003194.5	F: CACGAACCACGGCACTGATT	62
TBP	Transcription, metabolic pathways	NM_003194.5	R: TTTTCTTGCTGCCAGTCTGGA	62
YWHAZ	Signal transduction	NM_001135702	F: TGATCCCCAATGCTTCACAAG	61
YWHAZ	Signal transduction	NM_001135702	R: GCCAAGTAACGGTAGTAATCTCC	61
RUNX2	Master transcription factor for osteogenesis	NM_001015051	F: TGGTTACTGTCATGGCGGGTA	62
RUNX2	Master transcription factor for osteogenesis	NM_001015051	R: TCTCAGATCGTTGAACCTTGCTA	62
EF1α	Translation	NM_001402	F: GAAGCTGGTATCTCCAAGAATGG	61
EF1α	Translation	NM_001402	R: CGACAATTAGTTGTTTCACACCC	61
GAPDH	Mitochondrial metabolism	NM_002046	F: GCATCCTGGGCTACACTGA	60
GAPDH	Mitochondrial metabolism	NM_002046	R: CCACCACCCTGTTGCTGTA	60
ACTB	Cytoskeleton	NM_001101	F: CGACAGGATGCAGAAGGAG	60
ACTB	Cytoskeleton	NM_001101	R: TCCTGCTTGCTGATCCACAT	60
B2M	Immune response	NM_004048	F: GAGGCTATCCAGCGTACTCCA	62
B2M	Immune response	NM_004048	R: CGGCAGGCATACTCATCTTTT	62
ALAS1	Mitochondrial metabolism	NM_199166	F: AAATGAATGCCGTGAGGAAAGA	60
ALAS1	Mitochondrial metabolism	NM_199166	R: CCCTCCATCGGTTTTCACACTA	60
TUB	Cytoskeleton	NM_001293212	F: TCAACACCTTCTTCAGTGAAACG	60
TUB	Cytoskeleton	NM_001293212	R: AGTGCCAGTGCGAACTTCATC	60
SDHA	Mitochondrial metabolism	NM_004168	F: CAAACAGGAACCCGAGGTTTT	60
SDHA	Mitochondrial metabolism	NM_004168	R: CAGCTTGGTAACACATGCTGTAT	60

ACTB: Actin beta; ALAS1: Aminolevulinic acid synthase 1; B2M: Beta-2-microglobulin; EF1α: Eukaryotic translational elongation factor 1 alpha; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; NCBI: National Cancer for Biotechnology Information: RPLP0: Ribosomal protein, large, P0; RUNX2: Runt-related transcription factor 2; SDHA: Succinate dehydrogenase complex, subunit A, flavoprotein; TBP: TATA-binding protein; TUB: Tubulin; YWHAZ: Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta.

Table 2 Gene stability of overall analysis from clonogenic and osteogenic samples

Main group	Rank	Delta Ct		NormFinder		geNorm		BestKeeper
Main group	Rank	Gene	Stability value	Gene	Stability value	Gene	M value	Gene	Std Dev	R	P value
1 to 35 d (clo + ost)	1	TBP	2.13	TBP	1.078	RPLP0/EFα1	0.889	ALAS1	0.70	0.335	0.003
	2	RPLP0	2.27	RPLP0	1.451	-	-	RPLP0	1.33	0.726	0.001
	3	YWAHZ	2.37	YWAHZ	1.62	TBP	1.712	EFα1	1.41	0.668	0.001
	4	EFα1	2.43	ACTB	1.659	YWAHZ	1.923	GAPDH	1.78	0.571	0.001
	5	ACTB	2.43	EFα1	1.707	SDHA	2.037	TBP	1.87	0.857	0.001
	6	ALAS1	2.55	ALAS1	1.84	ALAS1	2.152	ACTB	2.00	0.785	0.001
	7	SDHA	2.57	SDHA	1.948	ACTB	2.261	YWAHZ	2.40	0.876
	8	TUB	2.68	TUB	2.06	B2M	2.337	TUB	2.41	0.777
	9	B2M	2.72	B2M	2.122	TUB	2.402	SDHA	2.59	0.847
	10	GAPDH	2.93	GAPDH	2.385	GAPDH	2.508	B2M	2.63	0.799	0.001

ACTB: Actin beta; ALAS1: Aminolevulinic acid synthase 1; B2M: Beta-2-microglobulin; clo: Clonogenic; EF1α: Eukaryotic translational elongation factor 1 alpha; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; ost: Osteogenic; RPLP0: Ribosomal protein, large, P0; SDHA: Succinate dehydrogenase complex, subunit A, flavoprotein; Std Dev: Standard deviation; TBP: TATA-binding protein; TUB: Tubulin; YWHAZ: Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta.

Table 3 Gene stability from Subset 1 (clonogenic medium under 35 d) and Subset 2 (osteogenic medium under 35 d)

Subset	Rank	Delta Ct		NormFinder		geNorm		BestKeeper
Subset	Rank	Gene	Stability value	Gene	Stability value	Gene	M value	Gene	Std Dev	R	P value
1: 1 to 35 d (clo)	1	TBP	2.040	TBP	1.024	TBP/YWAHZ	0.996	ALAS1	0.660	0.326	0.043
	2	RPLP0	2.220	RPLP0	1.423	-	-	RPLP0	1.200	0.700	0.001
	3	YWAHZ	2.220	YWAHZ	1.466	B2M	1.319	EFα1	1.250	0.537	0.001
	4	B2M	2.430	B2M	1.790	SDHA	1.449	GAPDH	1.660	0.647	0.001
	5	ACTB	2.460	ACTB	1.818	RPLP0	1.880	TBP	1.900	0.866	0.001
	6	ALAS1	2.480	ALAS1	1.821	EFα1	2.068	ACTB	2.140	0.799	0.001
	7	GAPDH	2.500	GAPDH	1.824	ALAS1	2.159	YWAHZ	2.240	0.850	0.001
	8	EFα1	2.560	EFα1	1.989	GAPDH	2.272	TUB	2.510	0.800	0.001
	9	SDHA	2.620	SDHA	2.099	ACTB	2.356	B2M	2.560	0.855	0.001
	10	TUB	2.680	TUB	2.161	TUB	2.421	SDHA	2.710	0.875	0.001
2: 1 to 35 d (ost)	1	TBP	2.140	TBP	1.087	RPLP0/EFα1	0.515	ALAS1	0.740	0.324	0.044
	2	RPLP0	2.170	RPLP0	1.276	-	-	RPLP0	1.460	0.786	0.001
	3	EFα1	2.180	EFα1	1.291	TBP	1.450	EFα1	1.570	0.812	0.001
	4	ACTB	2.320	ACTB	1.467	YWAHZ	1.777	ACTB	1.720	0.767	0.001
	5	YWAHZ	2.450	YWAHZ	1.758	SDHA	1.860	TBP	1.850	0.846	0.001
	6	SDHA	2.480	SDHA	1.789	ACTB	2.010	GAPDH	1.920	0.519	0.001
	7	TUB	2.570	ALAS1	1.853	TUB	2.108	TUB	2.190	0.744	0.001
	8	ALAS1	2.570	TUB	1.882	ALAS1	2.184	SDHA	2.460	0.818	0.001
	9	B2M	2.970	B2M	2.456	B2M	2.323	YWAHZ	2.530	0.901	0.001
	10	GAPDH	3.270	GAPDH	2.833	GAPDH	2.512	B2M	2.640	0.739	0.001

Table 4 Gene stability from Subset 3 (clonogenic and osteogenic media from 1 to 21 d) and Subset 4 (clonogenic and osteogenic media from 21 to 35 d)

Subset	Rank	Delta Ct		Normfinder		geNorm		BestKeeper
Subset	Rank	Gene	Stability value	Gene	Stability value	Gene	M value	Gene	Std Dev	R	P value
3: 1 to 21 d (clo + ost)	1	TBP	2.160	TBP	1.202	RPLP0/EFα1	0.594	ALAS1	0.750	0.433	0.001
	2	RPLP0	2.230	RPLP0	1.419	-	-	RPLP0	1.100	0.614	0.001
	3	YWAHZ	2.320	ALAS1	1.492	ALAS1	1.207	EFα1	1.100	0.535	0.001
	4	EFα1	2.320	YWAHZ	1.550	TBP	1.639	TBP	1.770	0.801	0.001
	5	ALAS1	2.330	EEF1α1	1.591	YWAHZ	1.814	ACTB	1.940	0.703	0.001
	6	ACTB	2.580	ACTB	1.938	SDHA	1.989	GAPDH	2.010	0.683	0.001
	7	SDHA	2.640	B2M	1.979	B2M	2.104	YWAHZ	2.080	0.819	0.001
	8	B2M	2.640	SDHA	2.048	ACTB	2.275	B2M	2.210	0.709	0.001
	9	TUB	2.790	TUB	2.252	TUB	2.383	SDHA	2.290	0.785	0.001
	10	GAPDH	2.970	GAPDH	2.411	GAPDH	2.499	TUB	2.350	0.738	0.001
4: 21 to 35 d (clo + ost)	1	TBP	1.980	TBP	0.749	RPLP0/EFα1	1.039	ALAS1	0.630	0.345	0.039
	2	ACTB	2.090	ACTB	1.075	-	-	RPLP0	1.740	0.860	0.001
	3	RPLP0	2.120	RPLP0	1.155	ACTB	1.427	EFα1	1.890	0.815	0.001
	4	TUB	2.280	TUB	1.447	TBP	1.636	ACTB	1.920	0.893	0.001
	5	YWAHZ	2.300	YWAHZ	1.604	TUB	1.738	TBP	1.940	0.915	0.001
	6	EFα1	2.360	EEF1α1	1.605	YWAHZ	1.866	GAPDH	1.970	0.456	0.005
	7	SDHA	2.540	SDHA	1.979	SDHA	1.980	TUB	2.120	0.829	0.001
	8	ALAS1	2.670	ALAS1	2.044	B2M	2.087	YWAHZ	2.620	0.899	0.001
	9	B2M	2.760	B2M	2.283	ALAS1	2.210	SDHA	2.810	0.838	0.001
	10	GAPDH	3.420	GAPDH	3.075	GAPDH	2.452	B2M	2.930	0.830	0.001

Table 5 Gene stability from Subset 5 (only osteogenic medium from 1 to 21 d) and Subset 6 (only osteogenic medium from 21 to 35 d)

Subset	Rank	Delta Ct		NormFinder		geNorm		BestKeeper
Subset	Rank	Gene	Stability value	Gene	Stability value	Gene	M value	Gene	Std Dev	R	P value
5: 1 to 21 d (ost)	1	EFα1	2.200	EFα1	1.255	RPLP0/EFα1	0.463	ALAS1	0.810	0.440	0.022
	2	RPLP0	2.210	RPLP0	1.278	-	-	RPLP0	1.330	0.731	0.001
	3	TBP	2.280	TBP	1.325	ACTB	1.514	EFα1	1.330	0.755	0.001
	4	ALAS1	2.380	ALAS1	1.485	TUB	1.629	ACTB	1.540	0.555	0.003
	5	YWAHZ	2.450	YWAHZ	1.706	ALAS1	1.742	TBP	1.860	0.787	0.001
	6	ACTB	2.480	ACTB	1.757	TBP	1.978	TUB	1.880	0.620	0.001
	7	TUB	2.600	TUB	1.948	YWAHZ	2.115	YWAHZ	2.170	0.845	0.001
	8	SDHA	2.660	SDHA	2.043	SDHA	2.222	B2M	2.240	0.609	0.001
	9	B2M	2.950	B2M	2.369	B2M	2.345	SDHA	2.290	0.752	0.001
	10	GAPDH	3.460	GAPDH	3.031	GAPDH	2.568	GAPDH	2.310	0.647	0.001
6: 21 to 35 d (ost)	1	TBP	1.820	TBP	0.578	RPLP0/EFα1	0.495	ALAS1	0.560	0.257	0.304
	2	ACTB	1.900	ACTB	0.584	-	-	TBP	1.750	0.963	0.001
	3	RPLP0	2.050	RPLP0	1.096	ACTB	1.024	RPLP0	1.810	0.878	0.001
	4	EFα1	2.110	EFα1	1.224	TBP	1.134	EFα1	2.040	0.883	0.001
	5	SDHA	2.160	SDHA	1.368	SDHA	1.440	ACTB	2.070	0.963	0.001
	6	YWAHZ	2.300	TUB	1.551	YWAHZ	1.557	SDHA	2.250	0.843	0.001
	7	TUB	2.310	YWAHZ	1.648	TUB	1.655	TUB	2.400	0.856	0.001
	8	ALAS1	2.830	ALAS1	2.254	B2M	1.842	GAPDH	2.510	0.492	0.038
	9	B2M	2.840	B2M	2.401	ALAS1	2.035	YWAHZ	2.760	0.927	0.001
	10	GAPDH	4.040	GAPDH	3.776	GAPDH	2.435	B2M	2.800	0.810	0.001

ACTB: Actin beta; ALAS1: Aminolevulinic acid synthase 1; B2M: Beta-2-microglobulin; EF1α: Eukaryotic translational elongation factor 1 alpha; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; ost: Osteogenic; RPLP0: Ribosomal protein, large, P0; SDHA: Succinate dehydrogenase complex, subunit A, flavoprotein; Std Dev: Standard deviation; TBP: TATA-binding protein; TUB: Tubulin; YWHAZ: Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta.

Table 6 Gene stability from Subset 7 (only clonogenic medium from 1 to 21 d) and Subset 8 (only clonogenic medium from 21 to 35 d)

Subset	Rank	Delta Ct		NormFinder		geNorm		BestKeeper
Subset	Rank	Gene	Stability value	Gene	Stability value	Gene	M value	Gene	Std Dev	R	P value
7: 1 to 21 d (clo)	1	TBP	2.010	TBP	1.091	RPLP0/EFα1	0.661	ALAS1	0.690	0.379	0.051
	2	RPLP0	2.120	RPLP0	1.379	-	-	EEF1α1	0.820	0.144	0.473
	3	YWAHZ	2.150	YWAHZ	1.398	ALAS1	1.033	RPLP0	0.870	0.516	0.006
	4	ALAS1	2.150	ALAS1	1.404	TBP	1.430	TBP	1.600	0.778	0.001
	5	B2M	2.210	B2M	1.442	YWAHZ	1.617	GAPDH	1.630	0.722	0.001
	6	EFα1	2.370	GAPDH	1.615	B2M	1.718	YWAHZ	1.950	0.759	0.001
	7	GAPDH	2.370	EFα1	1.839	SDHA	1.890	B2M	1.980	0.762	0.001
	8	SDHA	2.610	SDHA	2.089	GAPDH	2.032	ACTB	2.180	0.789	0.001
	9	ACTB	2.630	ACTB	2.133	ACTB	2.212	SDHA	2.320	0.800	0.001
	10	TUB	2.920	TUB	2.546	TUB	2.354	TUB	2.660	0.815	0.001
8: 21 to 35 d (clo)	1	TBP	2.070	TBP	1.063	ACTB/TUB	0.766	ALAS1	0.670	0.480	0.044
	2	RPLP0	2.130	RPLP0	1.247	-	-	GAPDH	1.470	0.455	0.058
	3	TUB	2.200	TUB	1.378	RPLP0	1.417	RPLP0	1.680	0.841	0.001
	4	ACTB	2.210	ACTB	1.430	GAPDH	1.621	EEF1α1	1.780	0.752	0.001
	5	YWAHZ	2.280	YWAHZ	1.601	ALAS1	1.757	ACTB	1.780	0.801	0.001
	6	ALAS1	2.480	ALAS1	1.813	EEF1α1	1.932	TUB	1.850	0.799	0.001
	7	EFα1	2.580	EFα1	1.953	TBP	2.055	TBP	2.170	0.901	0.001
	8	GAPDH	2.680	B2M	2.231	YWAHZ	2.172	YWAHZ	2.520	0.862	0.001
	9	B2M	2.700	GAPDH	2.232	B2M	2.315	B2M	3.070	0.857	0.001
	10	SDHA	2.820	SDHA	2.388	SDHA	2.415	SDHA	3.240	0.884	0.001

ACTB: Actin beta; ALAS1: Aminolevulinic acid synthase 1; B2M: Beta-2-microglobulin; clo: Clonogenic EF1α: Eukaryotic translational elongation factor 1 alpha; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; RPLP0: Ribosomal protein, large, P0; SDHA: Succinate dehydrogenase complex, subunit A, flavoprotein; Std Dev: Standard deviation; TBP: TATA-binding protein; TUB: Tubulin; YWHAZ: Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta.

Citation: Ferreira DB, Gasparoni LM, Bronzeri CF, Paiva KBS. RPLP0/TBP are the most stable reference genes for human dental pulp stem cells under osteogenic differentiation. World J Stem Cells 2024; 16(6): 656-669
URL: https://www.wjgnet.com/1948-0210/full/v16/i6/656.htm
DOI: https://dx.doi.org/10.4252/wjsc.v16.i6.656