Copyright
©The Author(s) 2020.
World J Gastroenterol. Mar 28, 2020; 26(12): 1298-1316
Published online Mar 28, 2020. doi: 10.3748/wjg.v26.i12.1298
Published online Mar 28, 2020. doi: 10.3748/wjg.v26.i12.1298
Gene | Sequence |
LINC00488 | Forward: 5’ – GTTCACGGTGCTTCCTCAGA - 3’ |
Reverse: 5’ – GGGCGACAGAACAAGACTCA - 3’ | |
GAPDH | Forward: 5’ – GCACCGTCAAGGCTGAGAAC - 3’ |
Reverse: 5’ – TGGTGAAGACGCCAGTGGA - 3’ |
Characteristic | Number of cases | Risk | P value | |
Low (n = 253) | High (n = 253) | |||
Age (yr) | 0.057 | |||
≤ 60 | 163 | 71 | 92 | |
> 60 | 343 | 182 | 161 | |
Gender | ||||
Female | 230 | 112 | 118 | 0.655 |
Male | 276 | 141 | 135 | |
Stage | ||||
Stage I + II | 285 | 238 | 47 | < 0.011 |
Stage III + IV | 221 | 15 | 206 | |
Tumor invasion depth | ||||
T1 + T2 | 105 | 85 | 20 | < 0.011 |
T3 + T4 | 401 | 168 | 233 | |
Lymph node metastasis | ||||
N0 | 295 | 238 | 57 | < 0.011 |
N1 + N2 | 211 | 15 | 196 | |
Distant metastasis | ||||
M0 | 384 | 253 | 131 | < 0.011 |
M1 + M2 | 122 | 0 | 122 |
- Citation: Yang ZD, Kang H. Exploring prognostic potential of long noncoding RNAs in colorectal cancer based on a competing endogenous RNA network. World J Gastroenterol 2020; 26(12): 1298-1316
- URL: https://www.wjgnet.com/1007-9327/full/v26/i12/1298.htm
- DOI: https://dx.doi.org/10.3748/wjg.v26.i12.1298