Associations between interleukin-1 polymorphisms and gastric cancers among three ethnicities

Table 1 Primer sequences, polymerase chain reaction and denaturing high-performance liquid chromatography conditions for detection of gene polymorphisms

Gene	Primer sequence	PCR annealing temperature (°C)	PCR product size (bp)	DHPLC application type	Oven temperature (°C)
IL-1B-31	F: AGAAGCTTCCACCAATACTC	60	240	Mutation	59
	R: AGCACCTAGTTGTAAGGAAG
IL-1B-511	F: TGGCATTGATCTGGTTCATC	58.5	306	Mutation	60.5
	R: GTTTAGGAATCTTCCCACTT
IL-1 RN	F: CCCCTCGAGCAACATCC	59	270-442	VNTR	50.0
	R: GGTCAGAAGGGCAGAGA

DHPLC: Denaturing high-performance liquid chromatography; VNTR: Variable number of identical tandem repeats; PCR: Polymerase chain reaction; IL: Interleukin.

Table 2 Selective characteristics and risk factors in patients with gastric cancer and controls from the Tibet, Hui and Han ethnicities n (%)

Variable		Tibet				Hui				Han
		Cases(n = 155)	Controls(n = 210)	χ2	P value	Cases(n = 158)	Controls(n = 205)	χ2	P value	Cases(n = 197)	Controls(n = 202)	χ2	P value
Age, yr	< 35	3 (1.94)	5 (2.38)	0.006	0.940	2 (1.27)	2 (0.980)	0.069	0.793	5 (2.54)	5 (2.48)	0.602	0.437
	35-60	82 (52.90)	110 (52.38)	0.010	0.921	75 (47.46)	102 (49.76)	0.187	0.665	98 (49.75)	106 (52.48)	0.297	0.586
	≥ 60	70 (45.16)	95 (45.24)	0.000	0.988	81 (51.27)	101 (49.24)	0.142	0.706	94 (47.71)	91 (45.04)	0.285	0.593
Gender	Male	116 (74.84)	154 (73.33)	0.105	0.746	116 (73.42)	148 (71.20)	0.067	0.795	146 (74.62)	151 (74.75)	0.003	0.952
	Female	39 (25.16)	56 (26.67)			42 (26.58)	57 (28.80)			50 (25.38)	51 (25.25)
Smoking	Yes	99 (63.87)	135 (64.29)	0.007	0.935	28 (17.71)	40 (19.51)	0.188	0.665	131 (66.50)	129 (63.86)	0.200	0.655
	No	56 (36.13)	75 (35.71)			130 (82.29)	165 (80.49)			66 (33.50)	73 (36.14)
Hp	Positive	101 (65.16)	112 (53.33)	5.134	0.023	100 (63.29)	95 (46.34)	10.311	0.001	124 (62.94)	105 (51.98)	4.903	0.027
	Negative	54 (34.84)	98 (46.67)			58 (36.71)	110 (53.66)			73 (37.06)	97 (48.02)

Table 3 Genotype distributions of interleukin-1B-31, interleukin-1B-511 and interleukin-1RN gene polymorphisms among gastric cancer cases and controls from the Tibet, Hui and Han ethnicities n (%)

Genotype	Tibet				Hui				Han
	Cases	Controls	OR (95%CI)1	P value	Cases	Controls	OR (95%CI)1	P value	Cases	Controls	OR (95%CI)1	P value
IL-1B-31
TT	23 (14.84)	47 (22.38)	1		46 (29.11)	59 (28.78)	1		40 (20.30)	65 (32.18)	1
CT	81 (52.26)	112 (53.33)	1.47 (0.81-2.66)	0.208	79 (50.00)	105 (51.22	0.97 (0.58-1.62)	0.896	102 (51.77)	98 (48.52)	1.69 (1.03-2.76)	0.036
CC	51 (32.90)	51 (24.29)	2.10 (1.09-4.04)	0.027	33 (20.89)	41 (20.00)	1.03 (0.55-1.95)	0.919	55 (27.92)	39 (19.31)	2.29 (1.28-4.10)	0.005
IL-1B-511
CC	34 (21.94)	55 (26.19)	1		33 (20.89)	43 (20.98)	1		31 (15.74)	65 (32.17)	1
CT	80 (51.61)	93 (44.29)	1.37 (0.80-2.35)	0.210	88 (55.70)	110 (53.66)	1.04 (0.59-1.83)	0.888	101 (51.27)	99 (49.09)	2.16 (1.28-3.65)	0.004
TT	41 (26.45)	62 (29.52)	1.02 (0.56-1.86)	0.945	37 (23.41)	52 (25.37)	0.96 (0.50-1.84)	0.891	65 (32.99)	38 (18.81)	3.53 (1.49-8.33)	0.004
IL-1RN
L/L	129 (83.22)	185 (88.10)	1		94 (59.49)	156 (76.10)	1		166 (84.26)	171 (84.66)	1
2/L	26 (16.78)	25 (11.90)	1.50 (0.80-2.79)	0.206	64 (40.50)	49 (23.90)	2.11 (1.31-3.40)	0.002	31 (15.28)	31 (14.44)	1.03 (0.59-1.79)	0.924

¹Adjusted for age, sex, smoking status and Helicobacter pylori infection. IL: Interleukin; OR: Odds ratio.

Table 4 Genotype distributions of the interleukin-1B-31, interleukin-1B-511 and interleukin-1RN polymorphisms among different subtypes of gastric cancer in patients from the Tibet, Hui and Han ethnicities n (%)

	Tibet							Hui							Han
Genetype	Intestinal cases			Diffuse cases			Intestinal cases			Diffuse cases			Intestinal cases			Diffuse cases
	Controls	Cases	OR (95%CI)1	P value	Cases	OR (95%CI)1	P value	Controls	Cases	OR (95%CI)1	P value	Cases	OR (95%CI)1	P value	Controls	Cases	OR (95%CI)1	P value	Cases	OR (95%CI)1	P value
IL-1B-31
TT	47 (22.38)	16 (14.68)	1		7 (15.22)	1		59 (28.78)	33 (32.29)	1		13 (25.00)	1		65 (32.18)	28 (20.14)	1		12 (20.69)	1
CT	112 (53.33)	56 (51.38)	1.46 (0.75-2.84)	0.271	25 (54.35)	1.48 (0.59-3.70)	0.407	105 (51.22)	51 (48.11)	0.87 (0.49-1.54)	0.618	28 (53.85)	1.11 (0.51-2.39)	0.792	98 (48.52)	70 (50.36)	1.68 (0.97-2.90)	0.067	32 (55.17)	2.00 (0.82-4.88)	0.126
CC	51 (24.29)	37 (33.94)	2.17 (1.05-4.51)	0.037	14 (30.43)	1.86 (0.68-5.09)	0.228	41 (20.00)	22 (21.28)	0.93 (0.46-1.90)	0.845	11 (21.15)	1.18 (0.46-3.01)	0.734	39 (19.31)	41 (29.50)	2.51 (1.32-4.76)	0.005	14 (24.14)	1.79 (0.85-3.77)	0.126
IL-1B-511
CC	55 (26.19)	22 (20.18)	1		12 (25.53)	1		43 (20.98)	23 (21.70)	1		10 (19.23)	1		65 (32.17)	16 (11.51)	1		15 (25.86)	1
CT	93 (44.29)	54 (49.54)	1.48 (0.76-2.60)	0.277	26 (55.32)	1.28 (0.59-2.79)	0.535	110 (53.66)	58 (54.72)	1.00 (0.53-1.89)	0.998	30 (57.69)	1.13 (0.48-2.62)	0.784	99 (49.09)	69 (49.64)	2.74 (1.44-5.22)	0.002	32 (55.17)	1.45 (0.72-2.93)	0.301
TT	62 (29.52)	33 (30.28)	1.25 (0.64-2.42)	0.518	9 (19.15)	0.62 (0.24-1.63)	0.336	52 (25.37)	25 (23.58)	0.91 (0.43-1.92)	0.811	12 (23.08)	0.92 (0.34-2.50)	0.872	38 (18.81)	54 (38.85)	5.66 (2.82-11.33)	0	11 (18.97)	1.23 (0.50-3.02)	0.645
IL-1RN
L/L	185 (88.10)	93 (83.22)	1		36 (84.78)	1		156 (76.10)	64 (60.38)	1		30 (57.69)	1		171 (84.66)	116 (83.45)	1		50 (86.21)	1
2/L	25 (11.90)	16 (14.68)	1.32 (0.66-2.66)	0.439	10 (16.78)	1.87 (0.79-4.43)	0.158	49 (23.90)	42 (39.62)	2.08 (1.22-3.56)	0.007	22 (42.31)	2.31 (1.17-4.56)	0.016	31 (14.44)	23 (16.55)	1.09 (0.59-1.97)	0.807	8 (13.79)	1.02 (0.43-2.39)	0.971

¹Adjusted for age, sex, smoking status and Helicobacter pylori infection. IL: Interleukin; OR: Odds ratio.