In vitro differentiation of human umbilical cord Wharton’s jelly mesenchymal stromal cells to insulin producing clusters

Table 1 Primer pairs for amplification of transcription factors

Names	Forward (F) 5´-3´	Reverse(R) 5´-3´
Insulin	GCAGCCTTTGTGAACCAACA	TTCCCCGCACACTAGGTAGAGA
PDX1	GGATGAAGTCTACCAAAGCTCACGC	CCAGATCTTGATGTGTCTCTCGGTC
NGN3	CAATCGAATGCACAACCTCA	GGGAGACTGGGGAGTAGAGG
GLUT2	AGGACTTCTGTGGACCTTATGTG	GTTCATGTCAAAAAGCAGGG
NANOG	CAGAAGGCCTCAGCACCTAC	ATTGTTCCAGGTCTGGTTGC
Oct-4	CAGTGCCCGAAACCCACAC	GGAGACCCAGCAGCCTCAAA
β-actin	GATCGGCGGCTCCATCCTG	GACTCGTCATACTCCTGCTTGC

Table 2 Comparison between different methods of islet like cells clusters differentiation from different stem cell sources

Stem cell sources	Differentiation protocol	Efficiency(generation of insulin producing cell)	Ref.
Placenta-derived Mesenchymal stem cells	(α-MEM + 1% BSA + 1 × ITS + 0.3 mmol/L taurine) 3 d (α-MEM + 1.5% BSA + 1 × ITS + 3 mmol/L taurine + GLP-1 + nicotinamide) 7 d (α-MEM + 1.5% BSA + 1 × ITS + 3 mmol/L taurine + GLP-1 + nicotinamide) 10 d	65%-70% ILCs (represents 20%-25% beta-cells per islet)	Kadam et al[31]
Human embryonic stem cells	(DMEM-F12, 20% SR, 2 mmol/L GlutaMAX, 1% NEAA and 0.1 mmol β-mercaptoethanol) 7 d (DMEM-F12, 1% ITS, 2 mmol/L GlutaMAX, 5 μg/mL Fibronectin) 7 d (DMEM-F12, 1% N2, 2% B27, 2 mmol/L GlutaMAX, 10 ng/mL bFGF) 7 d (DMEM-F12, 1% N2, 2% B27, 2 mmol/L GlutaMAX, and 10 mmol/L nicotinamide) for 7-9 d	61.7% ± 9.5% insulin positive cells	Wei et al[32]
Human embryonic stem cells	(DMEM-F12, 100 ng/mL activin A, 1 μmol/L wortmannin, 1% N2, 1% B27) 4 d (IMDM/F12, 2 μmol/L retinoic acid, 20 ng/mL FGF7, 50 ng/mL Noggin, 0.25 μmol/L KAAD-cyclopamine, 1% B27) 4 d (DMEM, 50 ng/mL EGF, 1% ITS, 1% N2) 5 d (DMEM-F12, 1% ITS, 10 ng/mL bFGF, 10 mM nicotinamide, 50 ng/mL exendin-4) 7-9 d	41.6% ± 11.8% insulin positive cells	Wei et al[32]
hESC lines YT1 and YT2	(RPMI1640, 0.2% FBS, 0.56 N2, 0.56 B27, 100 ng/mL activin A, 1 mmol/L wortmannin) 4 d (RPMI1640, 0.5% FBS, 0.5% ITS, 0.56 B27, 2 mM retinoic acid, 20 ng/mL FGF-7, 50 ng/mL Noggin) 4 d (DMEM, 0.5% FBS, 1% ITS, 16 N2, 50 ng/mL EGF) 5 d (DMEM/F12, 1% ITS, 10 ng/mL bFGF, 10 mmol/L nicotinamide, 50 ng/mL exendin-4, 10 ng/mL BMP4) until maturation	17.1% insulin positive cells	Hua et al[33]
Human embryonic stem cells	(MCDB-LG, 100 ng/mL GDF8, 2.5 mmol/L MCX-928, 100 ng/mL) 1 d (MCDB-LG, 100 ng/mL GDF8) 2-4 d (MCDB-LG, 50 ng/mL FGF7) 2 d (MCDB-HG, 50 ng/mL FGF7, 20 ng/mL ActivinA, 0.25 μmol/L SANT-1, 2 μmol/L Retinoic Acid, 200 nmol/L LDN193189) 4 d (MCDB-HG, 0.25 μmol/L SANT-1, 200 nmol/L LDN193189, 500 nmol/L TBP, 100 nmol/L CYP26A inhibitor) 3 d (MCDB-HG, 200 nmol/L LDN193189, 1 μmol/L ALK5i, 100 nmol/L CYP26A inhibitor) 3 d (MCDB-HG, 200 nmol/L LDN193189, 1 μmol/L ALK5i) 3 d (MCDB-HG, 200 nmol/L LDN193189, 1 μmol/L ALK5i, 100 nmol/L VitaminA) 7-14 d	6%-10% insulin positive cells	Bruin et al[34]
Human embryonic stem cells	(EB formation) 2 d (DMEM-F12, KSR, ActivinA, Retinoic acid) 6 d (DMEM-F12, KSR, bFGF, Noggin) 12 d (DMEM-F12, N2, B27, Laminin, bFGF, Nicotinamid, GLP-1) 12 d (CMRL1066, Nicotinamid, ITS, Zn2SO4, Glutamax, HEPES, KSR, GLP-1, Exendin1, HGF) 10 d	24.5% insulin producing cell	Bose et al[35]
Bone marrow mesenchymal stem cells	(Human BMSCs were transfected with adenovirus carrying PDX1 or VEGF) 2 d	50% of cells was differentiated to beta cell	Milanesi et al[36]
Human bone marrow-derived stem cells	(RPMI 1640, 5.5 mmol/L glucose, 5% FCS, 10 mmol/L nicotinamide, 10 nmol/L exendin 4) 5 d	20% insulin producing cell	Tang et al[37]
Human bone marrow-derived mesenchymal stem cells	(DMEM, 0.5 mmol/L β-mercaptoethanol) 2 d ( DMEM, 1% non-essential amino acids, 20 ng/mL bFGF, 20 ng/mL EGF, 2% B27, 2 mmol/L L-glutamine) 8 d (DMEM, 10 ng/mL betacellulin, 10 ng/mL activin-A, 2% B27, 10 mmol/L nicotinamide) 8 d	5% insulin producing cell	Gabr et al[38]
Human labia minor dermis-derived fibroblasts	(DMEM/F12, ITS) 7 d (DMEM, 10% FBS, 100 U/mL penicillin/streptomycin, ITS, 10 mmol/L nicotinamide) 7 d	50% insulin positive cell 2 × 106 cells generated around 400–600 ICAs	Kim et al[39]
Human adipose tissue derived adult stem cells	(DMEM/F12, 17.5 mmol/L glucose, 1% BSA, 1 × ITS, 4 nmol/L activin A, 1 mmol/L sodium butyrate, 50 mmol/L 2-mercaptoethanol, 2 ng/mL FGF) 2 d (DMEM/F12, 17.5 mmol/L glucose, 1% BSA, ITS, 0.3 mmol/L Taurine) 2 d (DMEM/F12, 17.5 mmol/L glucose, 1.5% BSA, ITS, 3 mmol/L Taurine, 100 nmol/L GLP-1, 1 mmol/L nicotinamide and 1× non-essential amino acids) 12-14 d		Chandra et al[40]
Human Adult Fibroblast-Like Limbal Stem Cells	(RPMI-1640, 100 ng/mL Activin A) 2-3 d (RPMI-1640, 2% FBS, 50 ng/mL bFGF) 3-4 d (DMEM, 10% FBS, 1% B27, 2% N2, 1 mmol/L nicotinamide) 3-4 d (DMEM, 10% FBS, 1% B27, 2% N2, 1 mmol/L nicotinamide, 50 ng/mL exendin-4) 3-4 d	70% to 77% insulin producing cell	Criscimanna et al[41]
	(RPMI-1640, 100 ng/mL Activin A) 2-3 d (RPMI-1640, 2% FBS, 50 ng/mL FGF 10 μmol/L) 3-4 d (DMEM, 1% B27, 50 ng/mL FGF 10.2 μmol/L retinoic acid) 3-4 d (DMEM, 1% B27, 50 ng/mL exendin-4) 3-4 d
Dental pulp stem cells	(DMEM-KO, 1% BSA, 1x ITS, 4 nmol/L activin A, 1 mM sodium butyrate, 50 μmol/L 2-mercaptoethanol) 2 d (DMEM-KO, 1% BSA, ITS, 0.3 mmol/L taurine) 2 d (DMEM-KO, 1.5% BSA, ITS, 3 mmol/L taurine, 100 nmol/L GLP-1, 1 mmol/L nicotinamide, 1x non-essential amino acids) 5 d	2 × 106 (Number of cells generated from around 156 ± 23 ILCs)	Govindasamy et al[42]
Stem cells from human exfoliated deciduous teeth (SHED)	(KO-DMEM, 1% BSA, 1 × ITS, 4 nmol/L activinA, 1 mmol/L sodium butyrate) 2 d (KO-DMEM, 1% BSA, ITS, 0.3 mmol/L taurine) 1 d (KO-DMEM, 1.5% BSA, ITS, 3 mmol/L taurine, 100 nmol/L glucagon-like peptide-1, 1 mmol/L nicotinamide) 7 d	231 ± 21 number of generated ILCs from initial cell seeding density 2 × 106	Kanafi et al[43]
Dental pulp stem cells		112 ± 2 number of generated ILCs from initial cell seeding density 2 × 106	Kanafi et al[43]

MEM: Minimum Essential Medium Eagle; BSA: Bovine serum albumin; ITS: Insulin transferin selenium; ILCs: Islet like clusters; GlutaMAX: Glutamin; NEAA: Non-essential amino acids; DMEM: Dulbecco’s Modified Eagle Medium; bFGF: Basic Fibroblast growth factor; FGF7: Fibroblast growth factor 7; Cyclopamine-KAAD: A Smoothened (Smo) antagonist; EGF: Epidermal growth factor; BMP4: Bone morphogenetic protein 4; MCDP: Name of medium; LG: Low glucose; HG: High glucose; SANT-1: (4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine; HEPES: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; KSR: Name of medium for embryonic stem cell culture; GLP-1: Glucagon-like peptide-1; HGF: Hepatocyte growth factor; KO-DMEM: Knockout DMEM.