COVID-19-associated disseminated mucormycosis: An autopsy case report

Table 1 The identified DNA sequence of the fungi in the thrombi of the common iliac vein

Nucleotide sequence
GTAGGTGAACCTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAA

The sequence was 263 bp long.

Table 2 The Basic Local Alignment Search Tool results of the DNA sequencing

Scientific Name	Description	Query cover	Expect value	Percent identify	Accession length	Accession number
Rhizopus sp.	Rhizopus sp. isolate T78 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence	100%	1.00E-134	100	510	MT645142.1
Rhizopus arrhizus	Rhizopus arrhizus strain SFR-7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	100%	1.00E-134	100	654	MT540020.1
Rhizopus arrhizus	Rhizopus arrhizus strain YT-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence	100%	1.00E-134	100	269	MT477703.1
Rhizopus stolonifer	Rhizopus stolonifer isolate Rhi-st4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	100%	1.00E-134	100	624	MT256940.1
Rhizopus arrhizus	Rhizopus oryzae UICC 536 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	654	LC514334.1
Rhizopus arrhizus	Rhizopus oryzae UICC 135 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	657	LC514329.1
Rhizopus arrhizus	Rhizopus oryzae UICC 120 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	654	LC514326.1
Rhizopus arrhizus	Rhizopus oryzae UICC 119 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	658	LC514325.1
Rhizopus arrhizus	Rhizopus oryzae UICC 116 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	656	LC514324.1
Rhizopus arrhizus	Rhizopus oryzae UICC 85 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence	100%	1.00E-134	100	657	LC514323.1

Top 10 matched sequences producing significant alignments. The DNA sequence matched the sequence of Rhizopus arrhizus with an identity of 100%.