The effect of the duration of medication with metformin and sulfonylurea (SUs) on microvascular complications based on the duration of type 2 diabetes (DM2) is unclear. The aim of this study was to investigate the association of medication time with metformin and SUs and microvascular complications in newly diagnosed DM2 patients.

In this prospective multi-cohort study, data from 3,904 newly diagnosed DM from three cohorts of the Tehran Lipid and Glucose Study (TLGS), the Multi-Ethnic Study of Atherosclerosis (MESA), and the Atherosclerosis Risk in Communities (ARIC) with a mean age of 59.6 ± 08 years were pooled. Metformin medication time alone, SUs alone, and a combination of both since drug initiation were defined as exposure. The incidence of microvascular complications (diabetic nephropathy or retinopathy) was defined as outcomes. The cumulative exposure to metformin, SUs, aspirin, statin, and anti-hypertensive medication was also determined using the same approach.

Metformin alone, SUs alone, and the combination of both reduced the hazard of microvascular complications by 8%(HRAdj: 0.92, 95% CI: 0.89, 0.96, P: 0.001), 6%(HRAdj: 0.94, 95% CI: 0.92, 0.97, P: 0.004), and 9%(HRAdj: 0.91, 95% CI: 0.89, 0.94, P: 0.001) for each year of use, respectively (p < 0.05). The protective effect of metformin and SUs, individually or in combination, on microvascular complications started approximately five years after the initial treatment and continued until approximately 15 years after the initial treatment and then reached a plato.

long-term use of metformin and SUs individually and in combination was associated with a decrease in the risk of microvascular outcomes in newly diagnosed DM for up to about one decade. These findings highlight the importance of choosing an appropriate treatment regimen for new patients with type 2 diabetes. Appropriate oral therapy can minimize microvascular complications and improve overall well-being.

The online version contains supplementary material available at 10.1007/s40200-025-01577-w.

The prevention of orthopedic infections is of critical importance to improve patient outcomes and reduce health care costs. Preventative strategies can be employed preoperatively, including mitigation of medical risk factors, methicillin-resistant Staphylococcus aureus decolonization, appropriate skin preparation, and optimizing perioperative antimicrobial prophylaxis; intraoperatively, including utilizing irrigation, topical antibiotics, infection control measures, and timely debridement/optimal surgical techniques; and postoperatively, including consideration of antibiotic duration after primary arthroplasty and reimplantation. This article provides an evidence-based discussion of these strategies while also highlighting areas where ongoing research may be beneficial.

There is currently a limited understanding of the process of initiating standard insulin pump therapy (IPT) and how this differs with pump type. A time-and-motion study was conducted in Germany and the United Kingdom (UK) to evaluate the time required for initiation with a tubeless insulin pump (a pod) versus other tubed pumps.

The time taken to initiate patients onto tubeless IPT and tubed IPT (excluding automated insulin delivery systems, AID) was self-recorded by diabetes specialist nurses using a web-based tool. Pump users were adults with and without prior experience of IPT, and initiations were conducted face-to-face and remote.

In 276 recorded initiations (112 tubeless, 164 tubed, 89% type 1 diabetes), the mean time for initiating tubeless IPT was 13 min shorter compared with tubed IPT, 118 min [standard deviation (SD): 94] vs. 131 min [SD: 109]; p < 0.001. There was a particular benefit in people transferring from multiple daily injections (MDI) and for all initiations in a face-to-face setting. People transferring from MDI in a face-to-face setting had the highest time saving with tubeless IPT (24 min per nurse per initiation, p = 0.001), and this was also substantial for people in the face-to-face setting from both MDI and prior IPT (15 min per nurse per initiation, p = 0.002). According to survey responses, nurses reported initiations on tubeless IPT to be as effective as on tubed IPT despite taking less time.

This novel time-and-motion study identified significant time reductions for initiating tubeless IPT vs. tubed IPT. Applying these time savings across pump services could increase efficiencies for initiating IPT and reduce workloads. Further time-and-motion studies for IPT and AID initiations are needed.

To evaluate the expression of salivary and serum Insulin-like growth factor-1 (IGF-1) and Insulin-like growth factor binding protein-3 (IGFBP-3) in individuals with and without diabetes and oral cancer.

The cross-sectional study included 4 groups (n = 12/group). Group I consisted of healthy individuals (controls), Group II individuals with type 2 diabetes (T2D) without oral cancer, Group III individuals had only oral cancer and Group IV individuals had oral cancer and T2D. Demographic characteristics and biochemical values were recorded. Salivary and serum IGF-1 and IGFBP-3 were measured using a quantitative sandwich ELISA technique.

Serum IGF-1 levels [Median (Inter-quartile range)] were highest among the control group [255 (135) ng/ml], followed by only T2D group [210 (147) ng/ml], oral cancer with T2D group [149 (45) ng/ml] and finally the oral cancer group [143 (81) ng/ml, p for trend = 0.004]. Salivary IGF-1 values were significantly higher in both the groups with T2D [T2D:0.42 (0.20) ng/ml; oral cancer with T2D: 0.40 (0.21) ng/ml] when compared to those with only oral cancer [0.27 (0.06) ng/ml] and controls: 0.17 (0.17) ng/ml], p for trend = 0.007]. Serum IGFBP-3 was significantly higher in both the oral cancer groups [without T2D: 13.1(10.4) ng/ml; with T2D: 14.9 (8.5) ng/ml] compared to only T2D [0.27 (0.06) ng/ml] and controls [8.7 (3.5) ng/ml, p for trend = 0.001]. However, no significant trend was observed in salivary IGFBP-3 levels.

IGF-1 and IGFBP-3 are not reliable biomarkers for oral cancer screening or risk prediction. Further research is needed to confirm if they can be used as prognostic tools during treatment.

Preventing type 2 diabetes during humanitarian crises is under-researched. In Venezuela, a third of adults have prediabetes amid a prolonged crisis.

This study assessed the effectiveness of an intensive weight reduction strategy aimed at achieving a 7% weight loss in Venezuelan individuals with elevated risk of type 2 diabetes.

A six-month pilot randomized clinical trial was conducted at a Community Health Center. Participants were assigned to the Diabetes Prevention Program (DPP) or a low-calorie liquid diet followed by DPP (LD-DPP). The LD-DPP group underwent a two-month liquid diet, followed by food reintroduction and DPP content. The DPP group received a transculturally adapted Group Lifestyle Balance curriculum through 16 group sessions. Both Intention to Treat and Per-Protocol analyses with Inverse Probability Weighting were conducted.

Of 127 adults (64 LD-DPP, 63 DPP), 70 (55.1%) completed the intervention. In the ITT analysis, 32.9% achieved the 7% weight loss goal, significantly higher in the LD-DPP arm (54.8%) compared to DPP (15.4%).

Initiating the DPP with intensive low-calorie restriction led to greater weight loss and improved chances of meeting weight loss goals during a humanitarian crisis.

We estimate the difference in direct healthcare costs of individuals diagnosed with diabetes depending on their glucose level, considering different timespans and subgroups. Using data from administrative registers of 285,450 individuals in Catalonia from 2013 to 2017, we used a fuzzy regression discontinuity design to estimate the causal effect of being diagnosed with diabetes at a given timespan (based on an average glucose value equal to or above 6.5%, the treated group) vs. not (having an average glucose level below the threshold, the control group) on healthcare costs across different timespans (6, 9, 12, 15, 18, 21, and 24 months after the first laboratory test) and distances, in days, between the laboratory test and the doctor's diagnosis. When average glucose level was the only independent parameter and the time until diagnosis was 30 days or less, at the cut-off value (6.5%) healthcare costs were between €3,887 and €5,789 lower for the treated group compared to the control group. Smaller differences were reported as the delay in diagnosis increased, even when additionally controlling for sociodemographic characteristics and health status. Our results highlight the importance of prompt diagnosis and might open the debate about the usefulness of the 6.5% reference value in the blood glucose level as the main diagnostic tool in diabetes.

In recent years, new drugs for the treatment of type 2 diabetes (T2D) have been proposed, including glucagon-like peptide 1 (GLP-1) agonists or sodium-glucose cotransporter 2 (SGLT2) inhibitors and dipeptidyl peptidase-4 (DPP-4) inhibitors. Over time, some of these agents (in particular, GLP-1 agonists and SGLT2 inhibitors), which were initially developed for their glucose-lowering actions, have demonstrated significant beneficial pleiotropic effects, thus expanding their potential therapeutic applications. This review aims to discuss the mechanisms, pleiotropic effects, and therapeutic potential of GLP-1, DPP-4, and SGLT2, with a particular focus on their cardiorenal benefits beyond glycemic control.

Patients undergoing gastrectomy often experience postprandial hypoglycaemia, late dumping syndrome, and night-time hypoglycaemia. However, countermeasures for post-gastrectomy hypoglycaemia rely on the patients' own efforts. We sought to investigate how post-gastrectomy hypoglycaemia could be nutritionally improved in patients with gastric cancer.

Single-centre prospective, open-labelled, randomized crossover study including patients aged 20-80 years diagnosed with gastric adenocarcinoma, which have undergone total or distal gastrectomy 1-5 years before the study. The patients consumed 100 ml of a low-carbohydrate/high-monounsaturated fatty acid formula orally 30 min after meals and before sleep (400 kcal/day) during the first or second half of a 14-day glucose-monitoring period. The effects of the low-carbohydrate/high-monounsaturated fatty acid formula on the time below range, that is, the percentage of time during which the glucose concentration was <70 mg/dl, and the coefficient of variation (CV) of the glucose concentration when the ideal time below range and CV were set at <5% and ≤36% respectively were assessed. Dumping symptoms were investigated before and after the study.

Thirty-eight patients were included in this study. In patients who had undergone total gastrectomy, the (median) daytime time below range, daytime CV, and night-time time below range remained high at 7.6% ((range) 0.0-45.0), 35.6% ((range) 9.5-50.5), and 10.8% ((range) 0.0-56.3) respectively, even after a long postoperative period. The (median) night-time time below range in patients who had undergone distal gastrectomy and total gastrectomy improved from 3.5% ((range) 0.0-47.9) to 1.4% ((range) 0.0-26.6) (P < 0.001, effect size 0.58) and 10.8% ((range) 0.0-56.3) to 9.4% ((range) 0.0-39.9) (P = 0.078, effect size 0.45) respectively. However, the daytime time below range and CV, as indicators of late dumping syndrome, did not change.

The low-carbohydrate/high-monounsaturated fatty acid formula improved post-gastrectomy night-time hypoglycaemia, but not daytime glycaemic variability or hypoglycaemia. Thus, further investigation of nutritional optimization is required.

Japan Registry of Clinical Trials, jRCT https://jrct.niph.go.jp/, identifier jRCTs s051210200.

Artificial Intelligence (AI) has been used to automate detection of retinal diseases from retinal images with great success, in particular for screening for diabetic retinopathy, a major complication of diabetes. Since persons with diabetes routinely receive retinal imaging to evaluate their diabetic retinopathy status, AI-based retinal imaging may have potential to be used as an opportunistic comprehensive screening for multiple systemic micro- and macro-vascular complications of diabetes.

We conducted a qualitative systematic review on published literature using AI on retina images to detect systemic diabetes complications. We searched three main databases: PubMed, Google Scholar, and Web of Science (January 1, 2000, to October 1, 2024). Research that used AI to evaluate the associations between retinal images and diabetes-associated complications, or research involving diabetes patients with retinal imaging and AI systems were included. Our primary focus was on articles related to AI, retinal images, and diabetes-associated complications. We evaluated each study for the robustness of the studies by development of the AI algorithm, size and quality of the training dataset, internal validation and external testing, and the performance. Quality assessments were employed to ensure the inclusion of high-quality studies, and data extraction was conducted systematically to gather pertinent information for analysis. This study has been registered on PROSPERO under the registration ID CRD42023493512.

From a total of 337 abstracts, 38 studies were included. These studies covered a range of topics related to prediction of diabetes from pre-diabetes or non-diabeticindividuals (n = 4), diabetes related systemic risk factors (n = 10), detection of microvascular complications (n = 8) and detection of macrovascular complications (n = 17). Most studies (n = 32) utilized color fundus photographs (CFP) as retinal image modality, while others employed optical coherence tomography (OCT) (n = 6). The performance of the AI systems varied, with an AUC ranging from 0.676 to 0.971 in prediction or identification of different complications. Study designs included cross-sectional and cohort studies with sample sizes ranging from 100 to over 100,000 participants. Risk of bias was evaluated by using the Newcastle-Ottawa Scale and AXIS, with most studies scoring as low to moderate risk.

Our review highlights the potential for the use of AI algorithms applied to retina images, particularly CFP, to screen, predict, or diagnose the various microvascular and macrovascular complications of diabetes. However, we identified few studies with longitudinal data and a paucity of randomized control trials, reflecting a gap between the development of AI algorithms and real-world implementation and translational studies.

Dr. Gavin Siew Wei TAN is supported by: 1. DYNAMO: Diabetes studY on Nephropathy And other Microvascular cOmplications II supported by National Medical Research Council (MOH-001327-03): data collection, analysis, trial design 2. Prognositc significance of novel multimodal imaging markers for diabetic retinopathy: towards improving the staging for diabetic retinopathy supported by NMRC Clinician Scientist Award (CSA)-Investigator (INV) (MOH-001047-00).

Diabetic neuropathy (DN) affects up to half of individuals with type 1 and type 2 diabetes. Despite evidence that improving metabolic and cardiovascular health can slow its progression, DN remains a significant clinical challenge due to the lack of disease-modifying therapies and effective pain management strategies. This consensus aimed to identify gaps and recommend strategies to address these challenges.

A workshop, initiated by Steno Diabetes Centre Copenhagen and the Danish Diabetes and Endocrinology Academy, conducted a gap analysis based on insights from clinical studies, observational cohorts, and clinical practice. Online invitations targeted experienced clinicians, researchers, and drug developers committed to improving DN treatment through innovative clinical trials. Thirty-five participants from six countries reached consensus via a Delphi process on key steps to advance DN therapy.

Four critical barriers and needs were addressed: (1) Translating bench research to clinical practice, (2) Enhancing clinical trial design, (3) Improving outcome measures, and (4) Identifying effective treatments for painful DN.

Successful interventional trials require robust outcome measures to capture clinically meaningful changes in DN phenotypes, providing the basis for developing effective, disease-modifying treatments.

Postoperative stress hyperglycemia is reported to be associated with increased postoperative complications (PCs) following various surgical procedures. However, most reports of postoperative hyperglycemia are based on conventional, point blood glucose measurements. We sought to clarify trends in post-gastrectomy glucose levels using continuous glucose monitoring (CGM) and investigate the relationship between postoperative hyperglycemia and stress-related factors such as PCs and the degree of surgical invasiveness.

The subjects of this prospective study were 40 patients who underwent gastrectomy between November, 2022 and September, 2023. We recorded their glucose levels by CGM immediately after surgery until discharge (up to 2 weeks postoperatively).

There was no increase in glucose levels caused by open gastrectomy, a strong inflammatory response, or PCs. Hyperglycemia, defined as the percentage of time that the glucose level was > 140 mg/dL, was associated only with the preoperative HbA1c value (P = 0.039). Patients with an HbA1c ≥ 6% had a significantly longer duration of hyper- and hypo-glycemia and greater glycemic variability than those with an HbA1c < 6% (glucose level < 70 mg/dL, P = 0.027; > 140 mg/dL, P = 0.001, coefficient of variation P = 0.024).

No association was observed between stress hyperglycemia during the acute phase following gastrectomy and PCs. Only patients with an elevated HbA1c had high rates of hypo- and hyper-glycemia and large glycemic variability, despite perioperative glucose management.

Heart failure (HF) with mildly reduced or preserved ejection fraction (HFpEF) accounts for over half of cases of HF, with obesity playing a key role. Residual risk remains high despite available therapies. Glucagon-like peptide-1 receptor agonists (GLP-1RAs) have shown potential cardiometabolic benefits, but their role in HFpEF remains unclear.

A systematic review and meta-analysis of randomized controlled trials evaluating GLP-1RAs in HFpEF were conducted. Studies evaluating GLP-1RA in combination with glucose-dependent insulinotropic polypeptide (GIP) were also included. The analyzed outcomes included cardiovascular (CV) death, worsening HF events and their composite. Hazard ratios (HRs) with 95% confidence intervals (CIs) were pooled by using a random-effects model.

Six randomized controlled trials involving 8788 patients were included. GLP-1RAs significantly reduced the composite outcome of CV death or worsening HF events (HR: 0.68 [0.51-0.89]; P = 0.006, I² = 47%) as well as worsening HF events alone (HR: 0.56 [0.38-0.82]; P = 0.003, I² = 51%). No significant reduction was observed for CV death alone (HR: 0.86 [0.67-1.12]; P = 0.27, I² = 0%).

GLP-1RAs reduce worsening HF events and the composite of CV death or worsening HF in HFpEF, particularly in patients with obesity or diabetes. These findings support their role as a promising therapy requiring further HFpEF-focused trials.

At present, China has become the country with the largest number of individuals with diabetes mellitus (DM) in the world, with a total of approximately 140 million patients, the majority of whom have type 2 DM (T2DM). Based on conventional nursing methods, community home care has important clinical significance in controlling blood sugar and disease progression.

To explore the impact of community public health nursing on treatment effect, health cognition, and self-management in patients with T2DM.

One hundred patients with T2DM were selected as the research subjects. The patients were divided into either a conventional nursing group or community nursing (CN) group using the random number table method. The conventional nursing group (50 cases) received routine care, while the CN group (50 cases) received community public health care in addition to routine care as that for the conventional nursing group. The rate of excellent and good blood glucose control, fasting blood glucose before and after care, 2-h postprandial blood glucose, health cognition, and self-management ability, and patient satisfaction were compared between the two groups.

The CN group had a higher rate of excellent blood sugar control than the conventional nursing group (88% vs 70%, P < 0.05). Before care, there was no significant difference in fasting blood glucose or 2-h postprandial blood glucose between the two groups of patients (P > 0.05). After nursing, fasting blood glucose and 2-h postprandial blood glucose were reduced to varying degrees in both groups, and both blood glucose levels in the CN group were lower than those of the conventional nursing group (P < 0.05). Compared with the scores before care, the cognitive level score for diabetes and self-management ability score improved after care in both groups. The cognitive level and self-management ability of patients in the CN group were higher than those of the conventional nursing group (P < 0.05). The overall satisfaction of the CN group was better than that of the conventional nursing group (98% vs 86%, P < 0.05).

Community public health care based on conventional care of T2DM can achieve better blood sugar control, and improve patients' health cognitive level and self-management ability.

There is limited investigation on the longitudinal association between common electrocardiogram (ECG) features and the incidence of obstructive sleep apnea (OSA). This study aimed to examine the association of common ECG features with the incidence of OSA in a prospective cohort.

2,563 participants aged 60 years or more were selected from the baseline survey of the Guangzhou Heart Study. OSA was evaluated by the Berlin Questionnaire. Eight electrocardiogram features including PR interval, QRS duration, QT interval, QTc interval, heart rate, P-wave, R-wave, and T-wave were extracted from 24-hour single-lead Holter. Relative risk (RR) with 95% confidence interval (CI) was estimated using the multivariate logistic regression model. A receiver operating characteristic (ROC) curve analysis was used to evaluate the predictive ability of ECG features.

397 (15.5%) participants were divided into the OSA group and 2,166 (84.5%) into the OSA non-group. When comparing the highest with the lowest quartiles, heart rate was related to a 30% reduced risk of OSA (RR: 0.70, 95%CI: 0.51-0.97) after adjustment for possible confounders. Participants with prolonged PR interval were more likely to be at risk of OSA (RR: 2.68, 95%CI: 1.02-6.55). No significant association was found between the other six ECG features and OSA risk. Area under ROC curve was 0.676 (95% CI: 0.648-0.704), 0.676 (95%CI: 0.648-0.704), and 0.678 (95%CI: 0.651-0.706) for heart rate, PR interval, and their combination, respectively.

The results suggest that heart rate and PR interval are related to OSA incidence. Future studies should be carried out in different populations, and consider the use of portable monitors together with scales to comprehensively determine OSA, and comprehensively elucidate the relationship of various ECG features and their changes with OSA occurrence.

Diabetes mellitus, an endocrine system disease, is a common disease involving many patients worldwide. Many studies are performed to evaluate the correlation between micronutrients/macronutrients on diabetes but few of them have a high statistical population and a long follow-up period. We aimed to investigate the relationship between intake of macro/micronutrients and the incidence of type 2 diabetes (T2D) using logistic regression (LR) and a decision tree (DT) algorithm for machine learning.

Our research explores supervised machine learning models to identify T2D patients using the Mashhad Cohort Study dataset. The study population comprised 9704 individuals aged 35-65 years were enrolled regarding their T2D status, and those with T2D history. 15% of individuals are diabetic and 85% of them are non-diabetic. For ten years (until 2020), the participants in the study were monitored to determine the incidence of T2D. LR is a statistical model applied in dichotomous response variable modeling. All data were analyzed by SPSS (Version 22) and SAS JMP software.

Nutritional intake in the T2D group showed that potassium, calcium, magnesium, zinc, iodine, carotene, vitamin D, tryptophan, and vitamin B12 had an inverse correlation with the incidence of diabetes (p < 0.05). While phosphate, iron, and chloride had a positive relationship with the risk of T2D (p < 0.05). Also, the T2D group significantly had higher carbohydrate and protein intake (p-value < 0.05).

Machine learning models can identify T2D risk using questionnaires and blood samples. These have implications for electronic health records that can be explored further.

Adherence to the American Diabetes Association (ADA) Standards of Medical Care is low. This study aimed to assist pharmacists in identifying patients for diabetes control interventions using unsupervised machine learning.

This study analyzed the 2021 Medical Expenditure Panel Survey and used a k-mode cluster analysis. Patient features analyzed were adherence to a select set of preventive measures from the ADA Standards of Medical Care (HbA1c test, foot examination, blood cholesterol test, dilated eye examination, and influenza vaccination) and some patient characteristics (age, gender, health insurance, insulin use, and diabetes-related complications).

The study included 1,219 patients with self-reported diabetes, and the adherence rate to the ADA standards was 33.72%. Five distinct clusters emerged: (A) moderate-complexity, privately insured male; (B) moderate-complexity, publicly insured female; (C) low-complexity, privately insured female; (D) high-complexity, publicly insured female; (E) moderate-complexity, publicly insured male. Groups B, C, and E exhibited nonadherence.

Pharmacists can target publicly insured elderly (Groups B and E) and privately insured middle-aged females (Group C) for interventions. For instance, pharmacists may help patients in Groups B and E locate existing resources in their insurance program and remind those in Group C of the importance of adequate diabetes care.

The REDUCE-IT randomized trial demonstrated a cardiovascular benefit of icosapent ethyl (IPE) but also raised potential safety signals for atrial fibrillation (AF) and serious bleeding. We aimed to evaluate the real-world safety of IPE versus mixed omega-3 polyunsaturated fatty acid (OM-3) formulations.

This retrospective active comparator new-user cohort study compared rates of new-onset AF and major bleeding (MB) among adult new users of IPE versus OM-3 in 2020-2024 US Veterans Affairs data. Daily drug exposure was determined via prescription dispensing dates. AF and MB outcomes were identified via validated algorithms based on the International Statistical Classification of Diseases and Related Health Problems, 10th revision, clinical modification. Confounding was accounted for via nearest-neighbor pairwise propensity score (PS) matching. The PS, constructed via logistic regression, was informed by expert-identified variables meeting the disjunctive cause criterion. Cox regression was used to estimate adjusted hazard ratios (aHRs), interpretable as average treatment effects for the treated.

Cohorts for analyses of AF and MB endpoints included 1927 and 2015 people, respectively, in each of the IPE and OM-3 exposure groups. The median age was 70 years, and the groups exhibited a predominance of white (80%) males (93%). The median follow-up time was 1.29 years per person. Baseline covariates were well balanced by treatment arm after PS matching. Incidence rates for AF were 7.29 versus 7.48 per 100 person-years among new users of IPE versus OM-3. The aHR for AF was 1.15 (95% confidence interval 0.82-1.63). Incidence rates for MB were 3.27 versus 3.35 per 100 person-years among new users of IPE versus OM-3. The aHR for MB was 1.22 (95% confidence interval 0.87-3.02).

Our measures of association were consistent with the null, but we were unable to rule out harms from IPE (vs. OM-3) more modest than a 63% increased rate of AF and threefold increased rate of MB.

The blood glucose levels in people with prediabetes mellitus (PDM) are regarded as too high to be normal but below the cutoff for diabetes mellitus (DM). Clinical indicators for PDM patients include impaired glucose tolerance (IGT), impaired fasting glucose (IFG), and/or hemoglobin A1c (HbA1c) levels between 5.7 and 6.4% (39-47 mmol/mol). PDM has been shown to raises the risk of cardiovascular disease (CVD) and mortality. Meanwhile, death and morbidity can be predicted by the new ventricular repolarization features of the electrocardiogram (ECG). Several studies have analyzed the connection between DM and the ventricular repolarization characteristics of ECG; however, few studies have examined the connection between PDM and these ventricular repolarization characteristics. This study evaluated the ECG ventricular repolarization parameters in individuals with PDM.

A retrospective case-control design was used. Randomly selected participants included 79 PDM patients (30 men, mean age: 39.7 ± 5.7 years) and 79 controls (30 men, mean age: 39.8 ± 5.2 years). ECG intervals analyzed were the distance from the beginning of the Q wave to the end of the T wave (QT), the distance between Q and S waves (QRS), the distance between the T wave's termination and point J (JT), and the distance between the peak and endpoint of the T wave (Tp-e), along with corrected and derived measures (corrected QT interval (QTc), the difference between the maximum and smallest QT intervals (QTd), corrected QTd (QTdc), corrected JT interval (JTc), Tp-e/QT, Tp-e/QTc, Tp-e/JT, Tp-e/JTc). Patient records were retrieved from the institution's database.

Both groups had comparable averages for age, gender, smoking, hyperlipidemia, body mass index (BMI), (p > 0.05 for each). Similarly, both groups had similar QT, QRS, and JT intervals. PDM patients had significantly greater heart rates (bpm), and QTc, QTd, QTdc, JTc, and Tp-e intervals (millisecond, ms) than the control group. The results were deemed significant when HbA1c levels were associated with every employed ECG measurement in our investigation.

In our study, the HbA1c value was shown to be moderately positively correlated with the heart rate and QTc, QTd, QTdc, JTc, and Tp-e intervals, all of which were determined to be significant. Additionally, the HbA1c value showed a weak positive correlation with Tp-e/QT, Tp-e/JT ratios, which were statistically significant. This study showed that patients with PDM are prone to ventricular arrhythmia in the early period of the disorder.

Although obesity is typically correlated with adverse outcomes in various diseases, certain acute critical illnesses exhibit a phenomenon known as the obesity paradox. This study evaluated sex-specific differences in the prognostic implications of the body mass index (BMI) of patients with severe acute kidney injury (AKI) requiring continuous renal replacement therapy (CRRT).

A multicenter retrospective cohort study.

Data from eight tertiary hospitals in Korea.

A total of 3805 critically ill patients receiving CRRT. Patients were categorized into four BMI groups: underweight, normal weight, overweight, and obese.

None.

There were 2308 male and 1497 female patients. The 90-day mortality risk significantly differed among BMI groups in the overall patient population and the male subpopulation but not the female subpopulation. Following adjustment for confounding variables, the 90-day mortality risk was higher in the underweight group than in the obese group (hazard ratio [HR], 1.20; 95% CI, 1.05-1.36; p = 0.006). Among male patients, the 90-day mortality risk was higher in both the underweight and normal weight groups than in the obese group (underweight: HR, 1.30; 95% CI, 1.10-1.53; p = 0.002 and normal weight: HR, 1.18; 95% CI, 1.04-1.35; p = 0.010); however, no such association was observed among female patients. Subgroup analysis demonstrated the obesity paradox in male patients of old age, with septic AKI, or with low albumin levels.

There were sex differences in the association between BMI and mortality in critically ill patients with severe AKI. Although the precise distribution of fat mass and muscle mass was not identified, obese male patients had a more favorable prognosis, which was not evident among female patients. These findings highlight the importance of considering sex-specific factors in understanding the complex relationship between obesity and mortality in critically ill patients with AKI.

This study examines the nutritional composition, phytochemical profiling, and antioxidant, antidiabetic, and anti-inflammatory potential of a methanolic extract of Spilanthes filicaulis leaves (MESFL) via in vitro, ex vivo, and in silico studies. In vitro antioxidant, antidiabetic, and anti-inflammatory activities were examined. In the ex vivo study, liver tissues were subjected to FeSO4-induced oxidative damage and treated with varying concentrations of MESFL. MESFL contains a reasonable amount of nitrogen-free extract, moisture, ash content, crude protein, and fat, with a lesser amount of crude fiber. According to GC-MS analysis, MESFL contains ten compounds, the most abundant of which are 13-octadecenal and Ar-tumerone. In this study, MESFL demonstrated anti-inflammatory activities via membrane stabilizing properties, proteinase inhibition, and inhibition of protein denaturation (IC50 = 72.75 ± 11.06 µg/mL). MESFL also strongly inhibited both α-amylase (IC50 = 307.02 ± 4.25 µg/mL) and α-glucosidase (IC50 = 215.51 ± 0.47 µg/mL) activities. Our findings also showed that FeSO4-induced tissue damage decreased the levels of GSH, SOD, and CAT activities while increasing the levels of MDA. In contrast, treatment with MESFL helped to restore these parameters to near-normal levels, which signifies that MESFL has great potential to address complications from oxidative stress. Furthermore, the in silico interaction of the GCMS-identified phytochemicals with the active sites of α-amylase and α-glucosidase via molecular and ensembled-based docking displayed strong binding affinities of Ar-tumerone and 4-hydroxy-3-methylacetophenone to α-amylase and α-glucosidase, respectively. Taken together, the biological activities of MESFL might be a result of the effects of these secondary metabolites.Communicated by Ramaswamy H. Sarma.

Diabetes mellitus (DM) is a multifactorial metabolic disorder that affects the body's ability to regulate blood sugar levels. Apple cider vinegar (ACV) could possibly improve diabetes; nevertheless, evidences provide conflicting results. This study aimed to evaluate the effects of ACV on glycemic profile in type 2 diabetes patients (T2DM) in controlled trials (CTs) by systematically reviewing and dose-response meta-analysis.

The Scopus, PubMed, and Web of Science databases were searched until November 2024 according to a systematic approach. All CTs investigating ACV's effects on glycemic factors were included. We used a random-effects model to calculate WMDs and 95% confidence intervals (CIs). The present study assessed publication bias, sensitivity analysis, meta-regression, and heterogeneity based on standard methods. We assessed the bias risk of the included studies using Cochrane quality assessments and used GRADE (Grading of Recommendations Assessment, Development, and Evaluation) to calculate evidence certainty. We registered the study protocol at Prospero (no. CRD42023457493).

Overall, we included seven studies in this meta-analysis. ACV significantly reduced fasting blood sugar (FBS) (WMD: -21.929 mg/dL, 95% CI: -29.19, -14.67, p < 0.001) and HbA1c (WMD: -1.53, 95% CI: -2.65, -0.41, p = 0.008) and increased insulin (WMD: 2.059 μu/ml, 95% CI: 0.26, 3.86, p = 0.025), while it did not affect hemostatic model assessment for insulin resistance (HOMA-IR). We observed linear and non-linear associations between ACV consumption and FBS levels (p < 0.001). Each 1 mL/day increase in ACV consumption was associated with a-1.255 mg/dL reduction in FBS. Moreover, greater effects on FBS were in dosages >10.

ACV had positive effects on FBS and HbA1c in T2DM patients.

The study protocol was registered at Prospero (no. CRD42023457493).

To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.

A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.

All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.

This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

This research assesses renoprotective effects of saracatinib (Src) in diabetic nephropathy (DN) and the potential underlying processes.

Rats were divided into: control, DN, DN + Met + Los, DN + Met + Src, and DN + Met + Los + Src. Rats' ABP, urinary albumin, urinary nephrin, and creatinine clearance were assessed. Blood samples were collected for measuring glycaemic state parameters, renal functions, oxidative stress markers, inflammatory mediators, aldosterone, and lipid profile. Kidneys were extracted for KIM-1 and nephrin gene expression, H&E, Masson's trichrome staining, and immunohistochemical assessment.

Significant increases in ABP, urinary albumin and nephrin, glycaemic measurements, urea, creatinine, aldosterone, inflammatory cytokines, MDA, lipids, renal fibrosis, H scores of VEGF and TGF-β, and renal KIM-1 expression were related to DN. However, there was a significant decrease in creatinine clearance, GSH, and nephrin expression in DN group compared with control group.

The combination of metformin (Met), losartan (Los), and Src repaired DN alterations. Adding Src to Met and Los is superior to using them alone.

Women with gestational diabetes mellitus (GDM) have a high risk of developing type 2 diabetes (T2D). Readiness for behaviour change to mitigate this risk may be low after pregnancy and may further decrease over time without appropriate interventions. This study aimed to evaluate readiness for behaviour change in the first and second postpartum years in women with recent GDM to determine the best timing for lifestyle interventions to prevent T2D.

This study included a subset of women with GDM between 2009 and 2013 in Ontario, Canada from a larger prospective cohort study who completed a survey in the first and second postpartum years (N = 329). The primary outcome was stage of readiness for behaviour change for diet and physical activity, compared between the first and second postpartum years.

The mean age was 34.3 ± 4.4 standard deviation (SD) years and mean pre-pregnancy body-mass index (BMI) was 26.7 ± 6.9 kg/m2. In the first postpartum year, 86% of women reported a pre-action stage of change, which was 87% by the second postpartum year (p = 0.646). Non-Caucasian ethnicity was associated with lower odds of being in the action stage of readiness for behaviour change overall and for physical activity in both time periods.

Most postpartum women with recent GDM are in a pre-action stage of change after delivery, which does not increase by the second postpartum year. Behavioural interventions should continue to be prioritized in postpartum women with GDM to optimize this slim window of opportunity for T2D prevention.

The glucose management indicator (GMI) and time-in-range (TIR) are important glycemic parameters calculated from continuous glucose monitoring (CGM) values. KARAZ, a hybrid Internet of things-artificial intelligence platform, was developed in Saudi Arabia to help manage diabetes mellitus. The complex nature of self-care and behavior changes associated with diabetes mellitus requires breaking large behaviors into achievable ones and related incentives.

This study explored how tiny habits as a behavioral intervention and incentive system affect glycemic control among KARAZ Platform users with diabetes mellitus in various age groups in Saudi Arabia.

This retrospective study included KARAZ Platform users and analyzed the effects of behavioral interventions and incentives on GMI and TIR as glycemic control parameters.

Of 296 active users, 118 (40%) and 148 (50%) maintained a desirable TIR and GMI, respectively. Adult females aged ≥ 26 years who consistently followed tiny habits and behavior changes exhibited a significant reduction in the GMI (5%). Intrinsic motivation through behavioral modification was more effective than external incentives for maintaining glucose control.

The findings highlight how behavioral interventions can impact GMI, suggesting their effectiveness in promoting better health behaviors and improving glycemic control in the Saudi Arabian context. Further research should investigate how these habits and behaviors can be maintained sustainably without relying on external incentives. Recommendations discussed how children with Type 1 diabetes mellitus would benefit from CGM connection to KARAZ Platform iteration and the integration of a comprehensive diabetes care program within the Saudi health system.

Experimental and clinical studies have suggested that symbiotics might effectively manage type 2 diabetes mellitus (T2DM) by modulating the intestinal microbiota. However, these studies' limited sources, small sample sizes, and varied study designs have led to inconsistent outcomes regarding glycaemic control. This study aimed to investigate the effects of symbiotics on the anthropometric measures, glycaemic control, and lipid profiles of patients with T2DM.

A double-blind, placebo-controlled, parallel clinical trial was conducted at two diabetes outpatient clinics. The main researcher and participants were blinded to the capsule content throughout the study. Sixty-six patients with T2DM aged 30-75 years were randomly allocated, using even and odd numbers, into two equal groups. These groups received either symbiotic capsules containing 200 million colony-forming units plus fructo-oligosaccharide or a placebo for 12 weeks. The primary objective was a decrement in glycated haemoglobin [HbA1c]. The patients' anthropometric measures, fasting blood sugar, high-density lipoprotein [HDL], low-density lipoprotein [LDL], total serum cholesterol and serum triglyceride levels were also assessed at baseline and after 12 weeks of intervention. Non-parametric tests were used for statistical analyses.

Within-group analysis revealed significant decreases in body mass index (BMI) and waist circumference (P = 0.005 and 0.023, respectively) and a significant increase in HDL levels in the symbiotic group (P = 0.04). HbA1c levels significantly increased in the placebo group (P = 0.016) but were not significantly reduced in the symbiotic group. The between-group analysis revealed significantly lower fasting blood sugar (FBS) levels in the symbiotic group, and higher in the placebo group (P = 0.02). No significant changes existed in total serum cholesterol, LDL, and triglyceride levels in either the symbiotic or placebo group.

Symbiotics improve BMI, waist circumference, HDL, and FBS levels and prevent the worsening of HbA1c levels in patients with T2DM. Our preliminary results indicate the potential benefits of symbiotics in patients with T2DM, which may lead to better diabetes control. However, this evidence requires further assessment in larger trials.

The trial was registered retrospectively at the International Standard Registered Clinical/Social Study Number Registry (ISRCTN34652973) on 05/01/2024.

Obesity is a multifactorial condition influenced by genetic, environmental, and microbiome-related factors. The gut microbiome plays a vital role in maintaining intestinal health, increasing mucus creation, helping the intestinal epithelium mend, and regulating short-chain fatty acid (SCFA) production. These tasks are vital for managing metabolism and maintaining energy balance. Dysbiosis-an imbalance in the microbiome-leads to increased appetite and the rise of metabolic disorders, both fuel obesity and its issues. Furthermore, childhood obesity connects with unique shifts in gut microbiota makeup. For instance, there is a surge in pro-inflammatory bacteria compared to children who are not obese. Considering the intricate nature and variety of the gut microbiota, additional investigations are necessary to clarify its exact involvement in the beginnings and advancement of obesity and related metabolic dilemmas. Currently, therapeutic methods like probiotics, prebiotics, synbiotics, fecal microbiota transplantation (FMT), dietary interventions like Mediterranean and ketogenic diets, and physical activity show potential in adjusting the gut microbiome to fight obesity and aid weight loss. Furthermore, the review underscores the integration of microbial metabolites with pharmacological agents such as orlistat and semaglutide in restoring microbial homeostasis. However, more clinical tests are essential to refine the doses, frequency, and lasting effectiveness of these treatments. This narrative overview compiles the existing knowledge on the multifaceted role of gut microbiota in obesity and much more, showcasing possible treatment strategies for addressing these health challenges.

The use of dapagliflozin in patients with cirrhosis has been relatively restricted due to concerns regarding its overall safety and pharmacological profile in this population.

To determine the safety and effectiveness of dapagliflozin in the co-management of diabetes mellitus and cirrhosis with or without ascites.

The patients studied were divided into two groups: 100 patients in the control group received insulin, while 200 patients received dapagliflozin. These patients were classified as Child A, B, or C based on the Child-Pugh classification. Child A or B and Child C were administered doses of 10 mg and 5 mg of dapagliflozin, respectively.

The rate of increased diuretics dose was markedly elevated in the group that received insulin compared to the group that received dapagliflozin. In addition, dapagliflozin treatment substantially reduced weight, body mass index, and fasting blood glucose compared to the insulin group during follow-up. However, there were no significant differences in hemoglobin A1c, liver function, or laboratory investigations between both groups during the follow-up period. The incidence of hypoglycemia, hepatic encephalopathy, variceal bleeding, and urinary tract infection was significantly higher in the insulin group compared to the dapagliflozin group. In contrast, the dapagliflozin group experienced significantly higher rates of frequent urination and dizziness. In addition, the insulin group exhibited a marked worsening of ascites compared to the dapagliflozin group.

Dapagliflozin demonstrated safety and efficacy in the treatment of diabetic patients who have cirrhosis with or without ascites. This resulted in an improvement of ascites, as well as a decrease in diuretic dose and Child-Pugh score.

This study used the Medical Expenditure Panel Survey data (2010-2018) to examine associations between diabetes patients' satisfaction with their provider and ratings of healthcare received, diabetes care self-efficacy, and monitoring adherence among nonpregnant reproductive age women with diabetes. The sample included nonpregnant women of childbearing age (18-45) with diabetes mellitus (n = 767; weighted n = 1.3 million women). The results indicated that patients who reported that their usual care provider always asked/showed respect for medical, traditional, and alternative treatments that the person is happy with had 2.59 times greater odds (95% confidence interval [CI]:1.32-5.10) of giving high ratings of healthcare (8-10) compared to those whose provider did not show respect for treatments. Results also showed that patients who reported they were asked to decide between a choice of treatments had 1.76 greater odds (95% CI:1.03-3.01) of diabetes care monitoring adherence. Findings demonstrate the importance of patient-centered communication experiences in relation to diabetes care monitoring adherence. Implications of the findings for clinical encounters are discussed.

A comprehensive evaluation of potential living kidney donors is crucial to ensure their short and long-term safety. We explored differences in kidney biochemical indicators, blood pressure measurements, and glucose control pre- and post-kidney donation between women with pre-diabetes and those with normal glucose levels.

We performed a prospective cohort study at West Bank and Gaza University hospitals between 2016 and 2022. Differences in sociodemographic and clinical factors that were collected from the participants' medical records between women with pre-diabetes and without diabetes, pre- and post-donation, were assessed using the chi-square test for categorical variables and the Mann-Whitney U test for variables with skewed distribution. Trained nurses performed anthropometric measurements and drew fasting blood samples at various time points from one year before donation to five years after donation.

Altogether, 114 female kidney donors (57 with pre-diabetes) aged 27-45 years (median = 35.7, IQR = 5.6) were included in the study. The post-donation median Body Mass Index (BMI) remained higher in women with pre-diabetes (35.02) than in those without diabetes (29.34) five years after donation, (P < 0.001). The 24 h protein, diastolic, and systolic blood pressure levels were significantly higher among women with pre-diabetes than among those without diabetes five years after donation, (P < 0.001). The median estimated glomerular filtration rate (eGFR) was significantly lower in pre-diabetic women (78.2 ml/min/1.73 m2) compared with the non-diabetic participants (87.9 ml/min/1.73 m2) five years after donation, (P < 0.001).

Pre-diabetic donors showed an increased risk of adverse outcomes, including hypertension, impaired oral glucose tolerance test, worsening kidney function, and proteinuria. Our findings underscore the importance of maintaining regular check-ups and follow-ups in particular in pre-diabetic kidney donors.

This was an ongoing quality-improvement (QI) project that aimed to assess the quality of nurse practitioner (NP)-driven diabetes care based on the 2023 American Diabetes Association (ADA) Standards of Care (SOC) at a NP-owned primary care practice. In addition, a more recent focus was the assessment of and intervention on social determinants of health (SDOH). Nationally, 47.4% of people with diabetes mellitus (DM) have an HbA1C of >7.0%. Adherence to ADA SOC for DM management minimizes the risk of diabetes-associated complications.

At a NP-owned clinic, within one year, the average A1Cs improved in all patients except those with positive SDOH despite receiving similar care. SDOH predicts DM prevalence and severity of progression, yet screening is not consistently performed or documented.

An ongoing retrospective chart review since 2013 has assessed adherence to ADA SOC among adult patients with type 2 DM at an NP-owned practice. Multiple Plan-Do-Study-Act (PDSA) cycles have resulted in new recommendations that have promoted adherence to diabetes metrics and improvement in overall mean A1C.

The current PDSA cycle emphasizes the creation and implementation of evidence-based interventions to assist NPs in addressing social needs at a NP-owned practice.

Recent data collection has included frequency of SDOH screening, identifying social needs, gaps in SDOH documentation, and has found overall higher A1Cs in patients with positive screens.

Project intervention of social workers collaboration with NPs resulted in improvement in addressing social needs in patients with type 2 diabetes mellitus.

The increasing frequency of total hip (THA) and knee arthroplasties (TKA) is marred by the rise in periprosthetic joint infections (PJIs) and surgical site infections (SSIs), with PJIs incurring costs over $1.62 billion as of 2020 and individual case management averaging $90,000. SSIs additionally burden the U.S. healthcare economy with billions in expenses annually. PJI prevalence in primary THA and TKA ranges from 0.5% to 2.4%, spiking to 20% in revisions and representing 25% of TKA revision causes. Projections estimate up to 270,000 annual PJI cases by 2030. Often caused by gram-positive bacteria, particularly methicillin-resistant staphylococci, these infections demand preventive measures. This review dissects PJI prevention across preoperative, intraoperative, and perioperative phases, aligning with evidence-based CDC and WHO guidelines. Preoperative measures include managing diabetes, obesity, tobacco use, Staphylococcus aureus screening and nasal decolonization, nutritional optimization, and management of inflammatory arthropathies. Intraoperatively, antibiotic prophylaxis, skin preparation, operative room environmental controls, surgical technique precision, and irrigation options are scrutinized. Perioperative concerns focus on anticoagulation, blood management, and infection risk mitigation. Integrating these strategies promotes a patient-centric care model, aiming to reduce PJI incidence, improve patient outcomes, and increase care cost-effectiveness in joint arthroplasty.

 Type 2 diabetes is a metabolic disorder characterized by insulin resistance and hyperglycemia affecting many individuals worldwide. For effective management, adherence to recommended physician visits is important, along with lifestyle modification and pharmacological interventions. Regular doctor visits can improve adherence and help prevent complications. This study examined how doctor-visit frequency impacts blood glucose (BG) control in people with type 2 diabetes.

 This retrospective, single-center study included adults with type 2 diabetes who had at least two visits and two hemoglobin A1c (HbA1c) values recorded at least 90 days apart between March 2019 and November 2023. Visit per quarter ratio (VQR) and the standardized delta HbA1c (ΔHbA1c) were defined. Data were analyzed for descriptive statistics and compared for significance between the groups. Statistical differences among the groups were determined using the Kruskal-Wallis test and Dwass-Steel-Critchlow-Fligner pairwise comparisons.

 Five hundred seventy-seven participants with type 2 diabetes were analyzed, with a mean age of 53.9 years (±12.7). The HbA1c outcome was significantly lower in the good compliance group (7.3%) than in the poor (7.7%). The high VQR group had a significantly lower HbA1c outcome (7.4%) than the low VQR group (7.7%); 50.98% (n = 104) in the low VQR group, 65.54% (n = 97) in the medium VQR group, and 60.44% (n = 136) in the high VQR group achieved HbA1c below the target. The mean ΔHbA1c was significantly lower in the good compliance group compared to the poor compliance group. The average follow-up durations were 11.22 quarters (±4.11) for low VQR, 9.75 quarters (±4.69) for medium VQR, and 5.50 quarters (±4.84) for high VQR.

 A higher frequency of follow-up may be needed to encourage people with type 2 diabetes mellitus to visit their doctor regularly. The frequency of doctor visits has a positive impact on BG control. Regular visits enable timely adjustment of therapy and ensure high compliance with prescribed treatment. These findings have significant implications for mitigating nonadherence in chronic conditions like type 2 diabetes mellitus and warrant further investigation.

Diabetes mellitus (DM) is a chronic metabolic disorder characterized by high blood sugar levels (hyperglycemia). Poorly managed diabetes can lead to complications affecting multiple organ systems. Antioxidants play a crucial role in reducing oxidative stress caused by reactive oxygen species (ROS), primarily triggered by uncontrolled high blood sugar levels in diabetes. Antioxidants like vitamin C, E, selenium, and alpha-lipoic acid, when used as supplements, have shown promise in reducing oxidative stress markers and improving antioxidant status in laboratory and animal studies and diabetic patients. Antioxidant supplementation may help reduce the risk of diabetic complications such as neuropathy, nephropathy, retinopathy, and cardiovascular disease. Additionally, antioxidants also have anti-inflammatory properties, which could be beneficial in reducing inflammation associated with diabetes. Antioxidant supplementation has been shown to enhance endothelial function, insulin sensitivity, and glucose metabolism, thereby aiding in glycemic control and overall diabetic management. Combining antioxidants with certain medications may have therapeutic benefits, such as effectively neutralizing free radicals and enhancing the regulation of antioxidant defense systems. This review presents an update on diabetes, the sources of free radical generation, the body's natural defense mechanisms, the clinical evidence regarding using antioxidants in managing diabetic complications, and the potential new therapeutic approaches. Overall, antioxidant supplementation may offer some benefits in managing diabetic complications. However, further studies are needed to understand the mechanisms of action, determine the optimal supplementation, explore potential interactions with other medications, and conduct long-term studies to establish the possible use of antioxidants for optimal benefits in diabetes care.

Objective: This review aims to emphasize the role of pharmacists for optimization of evidence-based outcomes of finerenone in multidisciplinary kidney care teams during the early detection process of CKD patients. Data Sources: A PubMed literature search was performed using keywords pharmacists, chronic kidney disease (CKD), type 2 diabetes (T2D), and finerenone. Study Selection and Data Extraction: All English-language studies on the role of pharmacists in managing CKD patients or finerenone prescriptions were evaluated. Data Synthesis: CKD is a major health problem affecting millions worldwide, especially those with T2D. In recent years, new drugs have been added to the treatment options for patients with T2D and CKD, which have been shown to reduce the risk of cardiovascular and renal complications in large clinical trials. Conclusions: Pharmacists can help detect and treat CKD in patients with T2D. They may use indicators to identify potential candidates for appropriate finerenone therapy, such as stage of CKD, albuminuria level, serum potassium concentration, and use of RAAS inhibitors. Pharmacists can provide education on the benefits and usage of finerenone, monitor response to therapy, adjust the medications and doses, prevent drug interactions, help with adherence and tolerability issues, and coordinate with other healthcare providers.

To examine the association between cumulative exposure to neighborhood walkability (NW) and diabetes risk.

A total of 11,037 women free of diabetes at enrollment were included. We constructed a 4-item NW index at baseline, and a 2-item average annual NW across years of follow-up that captured both changes in neighborhood features and residential moves. We used multivariable Cox PH regression models with robust variance to estimate the hazard ratios (HRs) of diabetes by NW scores.

Compared with women living in areas with lowest NW (Q1), those living in areas with highest NW (Q4) had 33 % (26 %-39 %) reduced risk of incident diabetes, using baseline NW, and 25 % (95 % CI 11 %-36 %), using average annual NW. Analysis using time-varying exposure showed that diabetes risks decreased by 13 % (10 %-16 %) per -standard deviation increase in NW. The associations remained similar when using inverse probability of attrition weights and/or competing risk models to account for the effect of censoring due to death or non-response. The associations of average annual NW with incident diabetes were stronger in postmenopausal women as compared to premenopausal women.

Long-term residence in more walkable neighborhoods may be protective against diabetes in women, especially postmenopausal women.

Our goal was to determine the prevalence of anxiety and depression in a sample of U.S. military veterans with type 2 diabetes and elevated diabetes distress (DD). Cross-sectional analyses were conducted. The association between DD and anxiety and depression was assessed with logistic regression. Almost 80% of persons with elevated DD had clinically significant anxiety or depression symptoms. The odds of depression and anxiety increased with DD severity. Given the large overlap of depression and anxiety with elevated DD, we recommend providers screen for all three conditions and, if positive, connect to resources for diabetes self-management and/or clinical treatment.

The prevalence of diabetes and chronic kidney disease (CKD) is increasing worldwide. Diabetic kidney disease is a chronic condition characterized by a gradual increase in urinary albumin excretion, blood pressure, cardiovascular risk, and a decline in glomerular filtration rate (GFR) that can progress to end-stage kidney disease (ESKD). Individuals with diabetes should be screened for CKD annually. Screening should include both measurement of albuminuria and estimation of GFR (eGFR). The structural changes in diabetic kidney disease in individuals with type 1 diabetes are rather uniform, but the histological picture in those with type 2 diabetes and CKD is on the contrary a mix of changes ranging from minor abnormalities to severe glomerulosclerosis, tubulointerstitial fibrosis, and arteriolohyalinosis. Scarring of the kidneys is closely related to the kidney function. Individuals with diabetes often require multiple therapies to prevent progression of CKD and its associated comorbidities and mortality. Management of cardiorenal risk factors, including lifestyle modification, control of blood glucose, blood pressure, and lipids, use of renin-angiotensin-aldosterone system (RAAS) blockers, use of sodium-glucose co-transporter 2 (SGLT2) inhibitors, and the non-steroidal mineralocorticoid receptor antagonist finerenone in individuals with T2D are the cornerstones of therapy. Primary care physicians (PCPs) play a critical role in identifying individuals with CKD, managing early stages of CKD, and referring those with moderate to severe CKD or rapidly declining kidney function to a nephrologist. Referral to a nephrologist should be considered when certain thresholds for eGFR, albuminuria, proteinuria, hematuria, or hypertension are exceeded. This review summarizes current guidelines for the management of CKD and its complications and highlights the role of PCPs in the care of individuals with CKD.

Prediabetes is prevalent in Saudi Arabia and globally. It is associated with adverse health outcomes and complications. Consequently, this study aimed to determine the risk factors associated with developing prediabetes in Saudi Arabia.

This is a case-control study conducted at the Family and Community Medicine Department at Prince Sultan Military Medical City, Riyadh, Saudi Arabia. The cases included individuals with prediabetes (prediabetes group), and the control group included individuals with normal HbA1c levels who were not diagnosed with prediabetes or diabetes. The data collected included sociodemographic data, clinical parameters, laboratory tests, and medical conditions.

The study included 46,201 patients (16,029 patients with prediabetes and 30,173 in the control group). The age of the patients (mean ± SD) with prediabetes was significantly higher than that of the control group (47.22 ± 14.04 versus 36.12 ± 11.83, p < 0.0001). A higher proportion of men was noted in the prediabetes group compared to the control group (36.32% versus 26.54%, p < 0.0001). The body mass index (mean ± SD) was higher in the prediabetes group compared to the control group (33.76 ± 6.75 versus 30.16 ± 7.26, p < 0.0001). The multiple logistic regression analysis showed six independent risk factors associated with prediabetes. These included age (aOR [95% CI] = 1.067 [1.065-1.069]) and gender, with women at a lower risk compared to men (aOR [95% CI] = 0.695 [0.664-0.728]). Other independent risk factors included polycystic ovarian syndrome (aOR [95% CI] = 58.102 (35.731-94.479]), obesity (aOR [95% CI] = 1.265 [1.075-1.487]), cardiac conditions (aOR [95% CI] = 4.870 [1.024-23.154]), and hypertension (aOR [95% CI] = 1.133 [1.031-1.245]).

The study showed that several risk factors are associated with the development of prediabetes in the Saudi population. Addressing these factors can help prevent prediabetes, and consequently, its burden and further progression to diabetes.

With the global increase in metabolic disorders, identifying effective dietary strategies is crucial for enhancing health outcomes. While various health advantages of alkaline reduced water (ARW) have been documented, its specific impacts on glucose and lipid metabolism in both healthy and diabetic conditions are still not well understood.

This study investigates how ARW affects carbohydrate and lipid metabolism in male Wistar rats, which were induced to develop glucose metabolism disorders through subcutaneous injections of nicotinamide and streptozotocin (STZ). The rats were allocated into four groups: one group received distilled water, another ARW, with similar arrangements for both non-diabetic and diabetic rats. Throughout the six-week experiment, the rats had unrestricted access to food and water. At the end of the study, blood and tissue samples were collected post-euthanasia for further analysis.

Non-diabetic rats consuming ARW experienced significant decreases in plasma glucose, triglycerides, cholesterol, insulin, leptin, and TBARS levels, along with reduced activities of hepatic hexokinase and intestinal sucrase. Meanwhile, there were increases in hepatic antioxidant enzyme activities, such as glutathione peroxidase and glucose-6-phosphate dehydrogenase, although glutathione levels decreased. In diabetic rats, ARW supplementation notably reduced plasma glucose and the glucose area under the curve, lowered hepatic glucose-6-phosphatase and intestinal disaccharidase activities, and raised hepatic GSH levels.

These findings suggest that ARW supplementation significantly enhances glucose and lipid metabolism and boosts antioxidant activity in both non-diabetic and diabetic rats, indicating its potential as a therapeutic aid for managing metabolic disorders.

prediabetes is a significant risk factor for the development of type 2 diabetes, cardiovascular diseases, chronic kidney disease, and other complications. Early diagnosis of prediabetes, coupled with education on lifestyle changes that support blood glucose management, are crucial for the prevention or delay of type 2 diabetes and related complications. This study aimed to evaluate the impact of incorporating real-time feedback from continuous glucose monitoring (CGM) into individualized nutrition therapy (INT) on blood glucose control in individuals with prediabetes who are overweight or obese.

participants (mean age ± SD: 55 ± 6 years; BMI: 31.1 ± 4.1 kg/m²) were randomly assigned to either the treatment group (n = 15) or the control group (n = 15). Both groups received INT and CGM, but the control group was blinded to the CGM data until the end of this study. Participants were followed for 30 days and visited the lab every 10 days for CGM replacement, study measurements, and dietary consultations.

the treatment group showed a significant increase in the percentage of time spent in the target blood glucose range (p = 0.02) and a significant decrease in the mean blood glucose concentration (p < 0.05), glucose management indicator (p = 0.02), percent coefficient of variation for blood glucose (p = 0.01), and percent time spent in the high or very high blood glucose ranges (p = 0.04). These changes were not statistically significant for the control group.

adding CGM feedback to INT resulted in better management of blood glucose levels in overweight or obese individuals with prediabetes.