Herpes Simplex Virus type 2 (HSV-2) is a neurotropic human pathogen. Upon de novo infection, the viral infected cell protein 0 (ICP0) is immediately expressed and interacts with various cellular components during the viral replication cycle. ICP0 is a multifunctional regulatory protein that has been shown to be important for both efficient viral replication and virus reactivation from latency. In particular, as previously demonstrated in transfected tissue culture models, ICP0 interacts with the cellular E3 ubiquitin ligase SIAH-1, which targets ICP0 for proteasomal degradation. However, the consequence of this virus-host interaction during the establishment of HSV-2 infection in vivo has not yet been elucidated. Here we confirmed that ICP0 of HSV-2 interacts with SIAH-1 via two conserved PxAxVxP amino acid binding motifs. We also demonstrate in vitro that a SIAH-1 binding-deficient HSV-2 strain, constructed by homologous recombination technology, exhibits an attenuated growth curve and impaired DNA and protein synthesis. This attenuated phenotype was also confirmed in an in vivo ocular infection mouse model. Specifically, viral load of the SIAH-1 binding-deficient HSV-2 mutant was significantly reduced in the trigeminal ganglia and brain stem at day 5 and 7 post infection. Our findings indicate that the interplay between ICP0 and SIAH-1 is important for efficient HSV-2 replication in vivo, thereby affecting viral dissemination kinetics in newly infected organisms, and possibly revealing novel targets for antiviral therapy.

Herpes simplex virus (HSV) immediate-early protein ICP0 is a transcriptional activator with E3 ubiquitin ligase activity that induces the degradation of ND10 proteins, including the promyelocytic leukemia protein (PML) and Sp100. Moreover, ICP0 has a role in the derepression of viral genomes and in the modulation of the host interferon response to virus infection. Here, we report that ICP0 interacts with SIAH-1, a cellular E3 ubiquitin ligase that is involved in multiple cellular pathways and is itself capable of mediating PML degradation. This novel virus-host interaction profoundly stabilized SIAH-1 and recruited this cellular E3 ligase into ICP0-containing nuclear bodies. Moreover, SIAH-1 mediated the polyubiquitination of HSV ICP0 in vitro and in vivo. After infection of SIAH-1 knockdown cells with HSV, higher levels of ICP0 were produced, ICP0 was less ubiquitinated, and the half-life of this multifunctional viral regulatory protein was increased. These results indicate an inhibitory role of SIAH-1 during lytic infection by targeting ICP0 for proteasomal degradation.

Simian varicella virus (SVV) is closely related to varicella-zoster virus (VZV), the causative agent of chickenpox and shingles. The SVV and VZV gene 61 polypeptides are homologs of the HSV-1 ICP0, a viral transactivator which appears to play a role in viral latency and reactivation. In this study, the molecular properties of the SVV 61 were characterized. The SVV open reading frame (ORF) 61 encodes a 54.1-kDa polypeptide with 37% amino acid identity to the VZV 61. Homology to the HSV-1 ICP-0 is limited to a conserved RING finger motif at the amino terminus of the protein. A nuclear localization sequence (nls) at the carboxy-terminus directs the SVV 61 to the cell nucleus, while a SVV 61nls(-) mutant is confined to the cell cytoplasm. The SVV 61 transactivates its own promoter as well as SVV immediate early (IE, ORF 62), early (ORFs 28 and 29), and late (ORF 68) gene promoters in transfected Vero cells. The RING finger and nls motifs are required for efficient SVV 61 transactivation. The SVV 61 has no effect on the ability of the major SVV transactivator (IE62) to induce SVV promoters. Generation and propagation of a SVV gene 61 deletion mutant demonstrated that the SVV 61 is non-essential for in vitro replication. SVV gene 61 is expressed in liver, lung, and neural ganglia of infected monkeys during acute simian varicella.

The IR2 protein (IR2P) is a truncated form of the immediate-early protein (IEP) lacking the essential acidic transcriptional activation domain (TAD) and serine-rich tract and yet retaining binding domains for DNA and TFIIB and nuclear localization signal (NLS). Analysis of the IR2 promoter indicated that the IR2 promoter was upregulated by the EICP0P. The IR2P was first detected in the nucleus at 5 h postinfection in equine herpesvirus 1 (EHV-1)-infected HeLa and equine NBL6 cells. Transient-transfection assays revealed that (i) the IR2P by itself downregulated EHV-1 early promoters (EICP0, TK, EICP22, and EICP27) in a dose-dependent manner; (ii) the IR2P abrogated the IEP and the EICP27P (UL5) mediated transactivation of viral promoters in a dose-dependent manner; and (iii) the IR2P, like the IEP itself, also downregulated the IE promoter, indicating that the IEP TAD is not necessary to downregulate the IE promoter. In vitro interaction assays revealed that the IR2P interacts with TATA box-binding protein (TBP). The essential domain(s) of the IR2P that mediate negative regulation were mapped to amino acid residues 1 to 706, indicating that the DNA-binding domain and the NLS of the IR2P may be important for the downregulation. In transient-transfection and virus growth assays, the IR2P reduced EHV-1 production by 23-fold compared to virus titers achieved in cells transfected with the empty vector. Overall, these studies suggest that the IR2P downregulates viral gene expression by acting as a dominant-negative protein that blocks IEP-binding to viral promoters and/or squelching the limited supplies of TFIIB and TBP.

The herpes simplex virus type 1 (HSV-1) immediate-early (IE) regulatory protein infected-cell protein 0 (ICP0) is a strong and global transactivator of both viral and cellular genes. In a previous study, we reported that ICP0 is highly phosphorylated and contains at least seven distinct phosphorylation signals as determined by phosphotryptic peptide mapping (D. J. Davido et al., J. Virol. 76:1077-1088, 2002). Since phosphorylation affects the activities of many viral regulatory proteins, we sought to determine whether the phosphorylation of ICP0 affects its functions. To address this question, it was first necessary to identify the regions of ICP0 that are phosphorylated. For this purpose, ICP0 was partially purified, and phosphorylation sites were mapped by microcapillary high-pressure liquid chromatography tandem mass spectrometry. Three phosphorylated regions containing 11 putative phosphorylation sites, all within or adjacent to domains important for the transactivating activity of ICP0, were identified. The 11 sites were mutated to alanine as clusters in each of the three regions by site-directed mutagenesis, generating plasmids expressing mutant forms of ICP0: Phos 1 (four mutated sites), Phos 2 (three mutated sites), and Phos 3 (four mutated sites). One-dimensional phosphotryptic peptide analysis confirmed that the phosphorylation state of each Phos mutant form of ICP0 is altered relative to that of wild-type ICP0. In functional assays, the ICP0 phosphorylation site mutations affected the subcellular and subnuclear localization of ICP0, its ability to alter the staining pattern of the nuclear domain 10 (ND10)-associated protein PML, and/or its transactivating activity in Vero cells. Only mutations in Phos 1, however, impaired the ability of ICP0 to complement the replication of an ICP0 null mutant in Vero cells. This study thus suggests that phosphorylation is an important regulator of ICP0 function.

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.

By selectively regulating the expression of the trans-dominant-negative mutant polypeptide UL9-C535C, of herpes simplex virus type 1 (HSV-1) origin binding protein UL9 with the tetracycline repressor (tetR)-mediated gene switch, we recently generated a novel replication-defective and anti-HSV-specific HSV-1 recombinant, CJ83193. The UL9-C535C peptides expressed by CJ83193 can function as a potent intracellular therapy against its own replication, as well as the replication of wild-type HSV-1 and HSV-2 in coinfected cells. In this report, we demonstrate that CJ83193 cannot initiate acute productive infection in corneas of infected mice nor can it reactivate from trigeminal ganglia of mice latently infected by CJ83193 in a mouse ocular model. Given that CJ83193 is capable of expressing the viral alpha, beta, and gamma1 genes but little or no gamma2 genes, we tested the vaccine potential of CJ83193 against HSV-1 infection in a mouse ocular model. Our studies showed that immunization with CJ83193 significantly reduced the yields of challenge HSV in the eyes and trigeminal ganglia on days 3, 5, and 7 postchallenge. Like in mice immunized with the wild-type HSV-1 strain KOS, immunization of mice with CJ83193 prevents the development of keratitis and encephalitis induced by corneal challenge with wild-type HSV-1 strain mP. Delayed-type hypersensitivity (DTH) assays demonstrate that CJ83193 can elicit durable cell-mediated immunity at the same level as that of wild-type HSV-1 and is more effective than that induced by d27, an HSV-1 ICP27 deletion mutant. Moreover, mice immunized with CJ83193 developed strong, durable HSV-1-neutralizing antibodies at levels at least twofold higher than those induced by d27. The results presented in this report have shed new light on the development of effective HSV viral vaccines that encode a unique safety mechanism capable of inhibiting the mutant's own replication and that of wild-type virus.

The equine herpesvirus 1 (EHV-1) immediate-early (IE) and EICP0 proteins are potent trans-activators of EHV-1 promoters; however, in transient-transfection assays, the IE protein inhibits the trans-activation function of the EICP0 protein. Assays with IE mutant proteins revealed that its DNA-binding domain, TFIIB-binding domain, and nuclear localization signal may be important for the antagonism between the IE and EICP0 proteins. In vitro interaction assays with the purified IE and EICP0 proteins indicated that these proteins interact directly. At late times postinfection, the IE and EICP0 proteins colocalized in the nuclei of infected equine cells. Transient-transfection assays showed that the EICP0 protein trans-activated EHV-1 promoters harboring only a minimal promoter region (TATA box and cap site), suggesting that the EICP0 protein trans-activates EHV-1 promoters by interactions with general transcription factor(s). In vitro interaction assays revealed that the EICP0 protein interacted directly with the basal transcription factors TFIIB and TBP and that the EICP0 protein (amino acids [aa] 143 to 278) mediated the interaction with aa 125 to 174 of TFIIB. Our unpublished data showed that the IE protein interacts with the same domain (aa 125 to 174) of TFIIB and with TBP. Taken together, these results suggested that interaction of the EICP0 protein with the IE protein, TFIIB, and TBP may mediate the antagonism between the IE and EICP0 proteins.

The EICP0 protein of equine herpesvirus 1 (EHV-1) is an early, viral regulatory protein that independently trans-activates EHV-1 immediate-early (IE), early, gamma1 late, and gamma2 late promoters. To assess whether this powerful trans-activator functions in conjunction with three other EHV-1 regulatory proteins to activate expression of the various classes of viral promoters, transient cotransfection assays were performed in which effector plasmids expressing the EICP22, EICP27, and IE proteins were used either singly or in combination with an EICP0 effector construct. These analyses revealed that (i) independently, the EICP0 and IE proteins are powerful trans-activators but do not function synergistically, (ii) the IE protein inhibits the ability of the EICP0 protein to trans-activate the IE, gamma1 late, and gamma2 late promoters, (iii) the EICP22 and EICP0 proteins do not function together to significantly trans-activate any EHV-1 promoter, and (iv) the EICP27 and EICP0 proteins function synergistically to trans-activate the early and gamma1 late promoters. A panel of EICP0 truncation and deletion mutant plasmids was generated and used in experiments to define the domains of the 419-amino-acid (aa) EICP0 protein that are important for the trans-activation of each class of EHV-1 promoters. These studies revealed that (i) carboxy-terminal truncation mutants of the EICP0 protein exhibited a progressive loss of trans-activating ability as increasing portions of the carboxy terminus were removed, (ii) the amino terminus of the EICP0 protein containing the RING finger (aa 8 to 46) and the acidic region (aa 71 to 84) was necessary but not sufficient for activation of all classes of EHV-1 promoters, (iii) the RING finger was absolutely essential for activation of EHV-1 promoters, since deletion of the entire RING finger motif (aa 8 to 46) or a portion of it (aa 19 to 30) completely abrogated the ability of these mutants to activate any promoter tested, (iv) the acidic region contributed to the ability of the EICP0 protein to activate the early and gamma1 late promoters, and deletion of the acidic region enhanced the ability of this mutant to activate the IE promoter, (v) the carboxy terminus (aa 325 to 419), which is rich in glutamine residues, was dispensable for the EICP0 trans-activation function, (vi) a motif resembling a nuclear localization signal (aa 289 to 293) was unnecessary for the EICP0 protein to trans-activate promoters of any temporal class, and (vii) the EICP0 protein was phosphorylated during infection, and deletion of the serine-rich region (aa 210 to 217), a potential site for phosphorylation, reduced by more than 70% the ability of the EICP0 protein to activate the gamma2 late class of promoters.

HSV regulatory proteins ICP0 and VP16 independently regulate transcription of the ICP0 gene during virus infection. In this study, we tried to determine the possible regulatory mechanism of ICP0 expression during virus infection. Among eight putative VP16 binding sites present in the ICP0 regulatory sequence, the most upstream one alone was sufficiently responsive to VP16-mediated activation. When the G/C-rich sequence present in front of the last TAATGARAT sequence of the ICP0 promoter was either deleted or point mutated, the activational effect of VP16 on the promoter was completely abolished. Furthermore, according to the gel mobility shift assay using a labeled double-stranded oligonucleotide derived from the G/C-rich sequence in the ICP0 promoter, specific protein binding to the probe was clearly demonstrated and was approximately fivefold upregulated by HSV-1 infection. Therefore, the G/C-rich sequence might play a critical role in VP16-mediated activation of the ICP0 promoter and the effect may be a result of the enhanced binding of a protein to the G/C-rich sequence during virus infection.

The transcriptional program of herpes simplex virus is regulated by the concerted action of three immediate-early (alpha) proteins, ICP4, ICP27, and ICP0. The experiments described in this study examine the role of the acidic amino terminus (amino acids 1 to 103) of ICP0 in gene activation. When tethered to a DNA binding domain, this sequence activates transcription in the yeast Saccharomyces cerevisiae. Deletion of these amino acids affects the ability of ICP0 to activate alpha-gene promoter reporters in transient expression assays, while it has little or no effect on a beta- and a gamma-gene reporter in the same assay. Viruses that express the deleted form of ICP0 (ICP0-NX) have a small-plaque phenotype on both Vero cells and the complementing cell line L7. Transient expression and immunofluorescence analyses demonstrate that ICP0-NX is a dominant negative form of ICP0. Immunoprecipitation of ICP0 from cells coinfected with viruses expressing ICP0-NX and ICP0 revealed that ICP0 oligomerizes in infected cells. These data, in conjunction with the finding that ICP0-N/X is dominant negative, provide both biochemical and genetic evidence that ICP0 functions as a multimer in infected cells.

The herpes simplex virus type 1 (HSV-1) immediate-early (IE) protein ICP0 has been implicated in the regulation of viral gene expression and the reactivation of latent HSV-1. Evidence demonstrates that ICP0 is an activator of viral gene expression yet does not distinguish between a direct or indirect role in this process. To further our understanding of the function of ICP0 in the context of the virus life cycle, site-directed mutagenesis of the consensus C3HC4 zinc finger domain was performed, and the effects of these mutations on the growth and replication of HSV-1 were assessed. We demonstrate that alteration of any of the consensus C3HC4 cysteine or histidine residues within this domain abolishes ICP0-mediated transactivation, alters the intranuclear localization of ICP0, and significantly increases its stability. These mutations result in severe defects in the growth and DNA replication of recombinant herpesviruses and in their ability to initiate lytic infections at low multiplicities of infection. These viruses, at low multiplicities of infection, synthesize wild-type levels of the IE proteins ICP0 and ICP4 at early times postinfection yet exhibit significant decreases in the synthesis of the essential IE protein ICP27. These findings reveal a role for ICP0 in the expression of ICP27 and suggest that the multiplicity-dependent growth of alpha0 mutant viruses results partially from reduced levels of ICP27.

To assess the role of the equine herpesvirus type 1 (EHV-1) ICP0 protein (EICP0) in gene regulation, a variety of molecular studies on the EICP0 gene and gene products of both the attenuated cell culture-adapted Kentucky A (KyA) strain and the Ab4p strain were conducted. These investigations revealed that (i) the ICP0 open reading frame (ORF) of the KyA virus strain is 1,257 bp in size and would encode a protein of 419 amino acids, and in comparison to the ICP0 gene (ORF63) of the Ab4p strain of 1,596 bp (E. A. Telford, M. S. Watson, K. McBride, and A. J. Davison, Virology 189:304-316, 1992), it has an internal in-frame deletion of 339 bp; (ii) one early transcript of 1.4 kb predicted to encode the EICP0 protein and a late transcript of 1.8 kb are detected in Northern blot analyses using probes containing the EICP0 ORF; (iii) the KyA EICP0 protein (50 kDa) and the Ab4p EICP0 protein (80 kDa) are expressed as several species of early proteins that are first detected at 3 to 4 h postinfection by Western blot analyses of infected-cell polypeptides, using an antiserum generated to a TrpE fusion protein that harbors amino acids 46 to 153 of the EICP0 protein; and (iv) the EICP0 protein of both EHV-1 strains is a potent transactivator of EHV-1 genes. Transient expression assays using a simian virus 40 expression construct of the EICP0 protein of the KyA strain showed that the EICP0 protein independently transactivated chloramphenicol acetyltransferase reporter constructs under the control of the immediate-early promoter (3.9-fold), the early thymidine kinase promoter (95-fold), the late (gamma1) IR5 promoter (85-fold), and the late (gamma2) glycoprotein K promoter (21-fold). The finding that the EICP0 protein of the KyA virus can function as an activator of gene expression indicates that amino acids corresponding to residues 319 to 431 of the Ab4p EICP0 protein are not essential for EICP0 transactivation of EHV-1 promoters.

ICP4, ICP0, and ICP27 are the immediate-early (IE) regulatory proteins of herpes simplex virus that have the greatest effect on viral gene expression and growth. Comparative analysis of viral mutants defective in various subsets of these IE genes should help elucidate how these proteins affect cellular and viral processes. This study focuses on the mutant d97, which is defective for the genes encoding ICP4, ICP0, and ICP27 and expresses the bacterial beta-galactosidase (beta-gal) gene from the ICP0 promoter. Together with the d92 virus (ICP4- ICP27-) and the ICP0-complementing cell line L7, d97 provided a unique opportunity to evaluate ICP0 function in the absence of the regulatory activities specified by ICP4 and ICP27. The pattern of protein synthesis in d97-infected cells was unique relative to other IE gene mutants in that it was similar to that seen in the absence of prior viral protein synthesis, possibly approximating the effect of cellular factors and virion components alone. Inactivation of ICP0 in the absence of ICP4 produced a significant decrease in the levels of the early mRNAs ICP6 and thymidine kinase (tk). There was also a marginal reduction in the levels of the IE ICP22 mRNA, and this was most notable at low multiplicity of infection (MOI). In d97-infected L7 cells, the levels of the viral mRNAs were mostly restored to those observed in infections with d92. Nuclear runoff transcription analysis demonstrated that the presence of ICP0 resulted in an increase in the transcription rates of the analyzed genes. The transcription rates of the early genes were dramatically reduced in the absence of ICP0. At low MOI, the transcription rates of ICP6 and tk were comparable to the rate of transcription of a cellular gene. Relevant to the potential use of d97 as a transfer vector, it was also determined that the absence of ICP0 reduced the cellular toxicity of the virus compared to that of d92. The beta-gal transgene expressed from an IE promoter was detected for up to 14 days postinfection; however, the level of beta-gal expression declined dramatically after 1 day postinfection. In the presence of ICP0, the level of expression of beta-gal was increased; however the infected monolayer was destroyed by 3 days postinfection. Therefore, deletion of ICP0 in the absence of ICP4 and ICP27 reduces toxicity and lowers the level of expression of genes from the viral genome.

The immediate-early protein ICP0 (infected-cell polypeptide 0) of herpes simplex virus type 1 (HSV-1) is a promiscuous transactivator of both viral and nonviral promoters in transient expression assays. Failure to splice the second of two introns in the ICP0 gene results in the utilization of an alternate stop codon that generates a truncated form of ICP0 called ICP0R. This protein exists in low levels in HSV-1-infected cells and functions as a dominant negative repressor of ICP0-mediated transactivation in transient expression assays. To conduct a detailed structure-function analysis of ICP0R, a series of insertion and deletion mutants of this protein were generated and analyzed in transfection assays. These studies indicated that segments of ICP0R that were rich in acidic amino acid residues (amino acids 9 to 76 and 233 to 241) or glycine residues (amino acids 242 to 262) were dispensable for the dominant negative phenotype. In contrast, the RING finger domain (amino acids 116 to 156) and surprisingly the sequences carboxy terminal to it (amino acids 157 to 232) were absolutely essential for transdominant repression. Consistent with these findings, the amino acid sequences of these two regions were conserved among other alphaherpesvirus ICP0 homologs. A construct containing only amino acids 76 to 232 inhibited ICP0-mediated transactivation almost as efficiently as wild-type ICP0R and represented the minimal sequences necessary for the dominant negative phenotype. These results demonstrated that the critical functional domain shared by both ICP0R and ICP0 is much more complex than a simple RING finger motif. Western blot (immunoblot) analyses of transfected cell lysates revealed that nearly all of the mutant constructs directed the expression of stable ICP0R proteins of the predicted molecular weight. However, there was a striking inverse correlation between the ability of a mutant construct to mediate transrepression and the amount of protein that it synthesized, indicating that dominant negative inhibition is achieved through the action of very little ICP0R protein.

The infected cell protein no. 0 (ICP0), the product of the alpha 0 gene, and an important herpes simplex virus 1 regulatory protein is encoded by three exons. We report that intron 1 forms a family of four stable nonpolyadenylylated cytoplasmic RNAs sharing a common 5' end but differing in 3' ends. The 5' and 3' ends correspond to the accepted splice donor and four splice acceptor sites within the mapped intron domain. The most distant splice acceptor site yields the mRNA encoding the 775-aa protein known as ICP0. The mRNAs resulting from the use of alternative splice acceptor sites were also present in the cytoplasm of infected cells and would be predicted to encode proteins of 152 (ICP0-B), 87 (ICP0-C), and 90 (ICP0-D) amino acids, respectively. Both the stability of the alpha 0 mRNA and the utilization of at least one splice acceptor site was regulated by ICP22 and or US1.5 protein inasmuch as cells infected with a mutant from which these genes had been deleted accumulated smaller amounts of alpha 0 mRNA than would be predicted from the amounts of accumulated intron RNAs. In addition, one splice acceptor site was at best underutilized. These results indicate that both the splicing pattern and longevity of alpha 0 mRNA are regulated. These and other recent examples indicate that herpes simplex virus 1 regulates its own gene expression and that of the infected cells through control of mRNA splicing and longevity.

Expression of human immunodeficiency virus type 1 (HIV-1) provirus can be stimulated by herpes simplex virus type 1 (HSV-1) infection; the stimulation occurs at the level of transcriptional activation of the HIV long terminal repeat (LTR) and is mediated by both cellular and HSV-1-encoded transactivators. We have shown in this study that HSV-1 immediate-early gene ICP0 cooperates effectively with the HIV-1-encoded transactivator, Tat, in the stimulation of HIV-1 LTR-directed transcription. The cooperation between ICP0 and Tat is specific for the HIV-1 LTR and was not observed with other promoters (e.g., ICP0) that can be transactivated by ICP0 but not by Tat. Analyses of HIV-1 LTR deletion mutants have shown that ICP0 not only transactivates an HIV-1 LTR mutant that is unresponsive to NF-kappaB and Tat-mediated transactivation, such as the HIV-1 LTR with the enhancer deleted (-83 LTR) and TAR deleted (+20 to +81), but also restores responsiveness to Tat. ICP0 also showed cooperation with Gal4-Tat fusion protein-mediated transactivation of Gal4-HIV-1 LTR with TAR deleted. Enhancement of the transcriptional activation of ICP0 by Tat requires both the cysteine-rich and core domains of Tat and is inhibited by RO5-3335. ICP0 stimulates transcription of not only the HIV-1 LTR but also the TAR-defective HIV-1 provirus. We suggest that ICP0 can (i) recruit Tat to the vicinity of the HIV-1 promoter, thereby providing an alternative binding site for Tat, and (ii) substitute for the enhancer-binding proteins that are required for efficient Tat transactivation in T cells.

During a productive infection by herpes simplex virus type 1 (HSV-1), ICP4, the major regulatory protein encoded by the alpha4 gene, binds to its transcription initiation site and represses the accumulation of alpha4 RNA. Evidence suggests that the degree of repression by ICP4 is a function of the absolute distance of an ICP4 binding site 3' from a TATA box. However, repression of HSV-1 gene expression by ICP4 through binding sites located 5' of TATA boxes, as in the case of the alpha0 gene, has not been adequately addressed. To this end, recombinant alpha0 promoters with various arrays of ICP4 binding sites flanking the alpha0 TATA box were constructed and recombined into the HSV-1 genome. Our results demonstrate the following. (i) Destruction of the endogenous alphaO ICP4 binding site, located 5' of the TATA box, results in derepression of alpha0 protein and RNA accumulation in infected Vero cells. (ii) The degree of alpha0 derepression is equivalent to that reported for the alpha4 gene following destruction of the ICP4 binding site at the alpha4 mRNA cap site in HSV-1. (iii) Introduction of an ICP4 binding site at the alpha0 mRNA cap site represses the accumulation of alpha0 RNA greater than threefold relative to the wild type. (iv) Changes in the abundance of alpha0 protein and RNA in infected cells do not affect replication or growth of HSV-1 in tissue culture. Our findings are consistent with the conclusion that alpha0 transcription is repressed by ICP4. These results demonstrate that repression by ICP4 can occur through binding sites located 5' of virus gene TATA boxes in HSV-1. Thus, models addressing repression of HSV-1 gene expression by ICP4 should incorporate the role of binding sites located 5', as well as 3', of virus gene TATA boxes.

Pseudorabies virus (PRV) early protein 0 (EP0) is a transactivator containing the RING finger domain. Analysis of transactivating activity of truncated forms of the EP0 molecule consisting of 410 amino acids revealed that amino-terminal region containing the RING finger domain, amino acids 1 to 84, and the region between amino acids 114 to 242 containing acidic amino acid sequences were required for the transactivation. On the other hand, the mutant consisting of amino acids 1 to 113 exhibited a dominant-negative property.

Among the five immediate-early regulatory proteins of herpes simplex virus (HSV) type 1, only ICP0 is capable of activating all kinetic classes of viral genes. Consistent with its broad transactivating activity, ICP0 plays a major role in enhancing the reactivation of HSV from latency both in vivo and in vitro. Although not essential for viral replication, ICP0 confers a significant growth advantage on the virus, especially at low multiplicities of infection. In this report we describe the expression of a novel activity by the osteosarcoma cell line U2OS that can substitute functionally for ICP0. Compared with Vero cells, both U2OS cells and cells of the ICP0-expressing line 0-28 significantly enhanced the plating efficiency of an ICP0 null mutant, 7134. In contrast, the plating efficiencies of the wild-type virus in all three cell types were similar. Single-step growth experiments demonstrated that the yield of 7134 in U2OS cells was severalfold higher than that in 0-28 cells and about 100-fold higher than that in Vero cells. In order to identify the viral genes whose expression is enhanced by the activity in U2OS cells, levels of expression of selected viral proteins in extracts of Vero and U2OS cells were compared by Western blot (immunoblot) analysis following low-multiplicity infection. At a multiplicity of 0.1 PFU per cell, the levels of expression of the immediate-early protein ICP4 and the early protein gD in 7134-infected U2OS cells were significantly higher than those in 7134-infected Vero cells. When infections were carried out at a multiplicity of 1 PFU per cell, however, no major differences in the levels of expression of these proteins in U2OS and Vero cells were observed. Cycloheximide reversal experiments demonstrated that the cellular activity expressed in U2OS cells that promotes high-level expression of ICP4 is not synthesized de novo but appears to exist as a preformed protein(s). To confirm this observation and to determine whether, like immediate-early genes, early, delayed-early, and late viral genes are also responsive to the cellular activity, transient-expression assays were performed. The results of these tests demonstrated that basal levels of expression from immediate-early, early, and delayed-early promoters, but not that from a late promoter, were significantly higher in U2OS cells than in Vero cells and that this enhancement occurred in the absence of viral proteins.(ABSTRACT TRUNCATED AT 400 WORDS)

Expression of the IE110 (ICP0) transactivator protein of HSV appears to be critical for reactivation from the latent state and occurs at immediate-early times during the lytic cycle under the control of an upstream divergent enhancer-promoter region that contains multiple Oct and Sp-1 binding sites overlapping with VP16 response elements. Surprisingly, the large 800-bp first intron of the HSV-1 IE110 gene also proved to have a complex repetitive organization encompassing multiple transcription factor binding sites within four distinct domains. DNaseI footprinting studies revealed that 13 of 17 copies of a 15-bp repeated element represented high-affinity binding sites for the cellular YY1 repressor protein. Between 4 and 7 of these sites are direct tandem repeats and the rest are interpersed with three repeated AT-rich motifs and a dyad symmetry region containing two strong AP-1 binding sites and an adjacent SP-1 binding site on each arm. Several of the YY1 sites also bound weakly to SRF. The intron also contains four clustered purine/pyrimidine tracts of between 16 and 23 bp long. Both the AP-1/AP-2/SP-1 dyad protein binding region and, to a lesser extent, the YY1 tandem-repeat cluster conferred responsiveness to TPA when placed upstream of a heterologous promoter in transient expression assays. The functional significance of the HSV-1 IE110 intron region is unknown as yet, but the novel arrangement of tandemly repeated YY1 sites has the potential to produce structural bending and transcriptional attenuation effects. Interestingly, few of these transcription factor binding motifs are conserved in the equivalent IE110 intron of HSV-2, and the domain appears to represent a unique alternative control region that is specific for HSV-1. Copyright 1995 S. Karger AG, Basel

The herpes simplex virus type 1 immediate-early protein ICP0 enhances expression of a spectrum of viral genes alone and synergistically with ICP4. To test whether ICP0 and ICP4 interact physically, we performed far-Western blotting analysis of proteins from mock-, wild-type-, and ICP4 mutant virus-infected cells with in vitro-synthesized [35S]Met-labeled ICP0 and ICP4 as probes. The ICP4 and ICP0 polypeptides synthesized in vitro exhibited molecular weights similar to those of their counterparts in herpes simplex virus type 1-infected cells, and the in vitro-synthesized ICP4 was able to bind to a probe containing the ICP4 consensus binding site. Far-Western blotting experiments demonstrated that ICP0 interacts directly and specifically with ICP4 and with itself. To further define the interaction between ICP0 and ICP4, we generated a set of glutathione S-transferase (GST)-ICP0 fusion proteins that contain GST and either ICP0 N-terminal amino acids 1 to 244 or 1 to 394 or C-terminal amino acids 395 to 616 or 395 to 775. Using GST-ICP0 fusion protein affinity chromatography and in vitro-synthesized [35S]Met-labeled ICP0 and ICP4, ICP4 was shown to interact preferentially with the fusion protein containing ICP0 C-terminal amino acids 395 to 775, whereas ICP0 interacted efficiently with both the N-terminal GST-ICP0 fusion proteins and the C-terminal GST-ICP0 fusion proteins containing amino acids 395 to 775. Fusion protein affinity chromatography also demonstrated that the C-terminal 235 amino acid residues of ICP4 are important for efficient interaction with ICP0. Collectively, these results reveal a direct and specific physical interaction between ICP0 and ICP4.

The 775-amino-acid IE110 (or ICP0) phosphoprotein of herpes simplex virus (HSV) functions as an accessory transcription factor during the lytic cycle and plays a critical role in reactivation from latent infection. By immunofluorescence analysis, IE110 localizes in a novel pattern consisting of several dozen spherical punctate granules in the nuclei of DNA-transfected cells. We constructed a hybrid version of IE110 that contained an epitope-tagged domain from the N terminus of the HSV IE175 protein and lacked the IE110 N-terminal domain that confers punctate characteristics. This hybrid IE175(N)/IE110(C) protein gave an irregular nuclear diffuse pattern on its own but was redistributed very efficiently into spherical punctate granules after cotransfection with the wild-type HSV-1 IE110 protein. Similar colocalization interactions occurred with internally deleted forms of IE110 that lacked the zinc finger region or large segments from the center of the protein, including both cytoplasmic and elongated punctate forms, but C-terminal truncated versions of IE110 did not interact. In all such interactions, the punctate phenotype was dominant. Evidence that C-terminal segments of IE110 could also form stable mixed-subunit oligomers in vitro was obtained by coimmunoprecipitation of in vitro-translated IE110 polypeptides with different-size hemagglutinin epitope-tagged forms of the protein. This occurred only when the two forms were cotranslated, not when they were simply mixed together. An in vitro-synthesized IE110 C-terminal polypeptide also gave immunoprecipitable homodimers and heterodimers when two different-size forms were cross-linked with glutaraldehyde and reacted specifically with a bacterial glutathione S-transferase/IE110 C-terminal protein in far-Western blotting experiments. The use of various N-terminal and C-terminal truncated forms of IE110 in the in vivo assays revealed that the outer boundaries of the interaction domain mapped between codons 617 and 711, although inclusion of adjacent codons on either side increased the efficiency severalfold in some assays. We conclude that the C-terminal region of IE110 contains a high-affinity self-interaction domain that leads to stable dimer and higher-order complex formation both in DNA-transfected cells and in in vitro assays. This segment of IE110 is highly conserved between HSV-1 and HSV-2 and appears to have the potential to play an important role in the interaction with the IE175 protein, as well as in correct intracellular localization, but it is not present in the equivalent proteins from varicella-zoster virus, pseudorabies virus, or equine abortion virus.

Transcriptional regulation by the IE175 (ICP4) and IE110 (ICP0) phosphorylated nuclear proteins encoded by herpes simplex virus (HSV) appears to be a key determinant for the establishment of successful lytic cycle infection. By indirect immunofluorescence in transient DNA transfection assays, we have examined the intracellular distribution of deletion and truncation mutants of both IE175 and IE110 from HSV-1. Insertion of short oligonucleotides encoding the basic amino acid motifs 726-GRKRKSP-732 from IE175 and 500-VRPRKRR-506 from IE110 into deleted cytoplasmic forms of the two proteins restored the karyophilic phenotype and confirmed that these motifs are both necessary and sufficient for proper nuclear localization. Analysis of IE110 deletion mutants and a panel of IE110/IE175 hybrid proteins was also used to evaluate the characteristic IE110 distribution within nuclear punctate granules as seen by immunofluorescence and phase-contrast microscopy. The phase-dense punctate pattern persisted with both large C-terminal truncations and deletions of the Cys-rich zinc finger region and even with a form of IE110 that localized in the cytoplasm, implying that the punctate characteristic is an intrinsic property of the N-terminal segment of the IE110 protein. Transfer of the full IE110-like punctate phenotype to the normally uniform diffuse nuclear pattern of the IE175 protein by exchange of the N-terminal domains of the two proteins demonstrated that the first 105 to 244 amino acids of IE110 represent the most important region for conferring punctate characteristics. Surprisingly, cotransfection of a wild-type nuclear IE175 gene together with the IE110 gene revealed that much of the IE175 protein produced was redistributed into a punctate pattern that colocalized with the IE110-associated punctate granules seen in the same cells. This colocalization did not occur after cotransfection of IE110 with the IE72 (IE1) nuclear protein of human cytomegalovirus and therefore cannot represent simple nonspecific trapping. Evidently, the punctate phenotype of IE110 represents a dominant characteristic that reveals the potential of IE110 and IE175 to physically interact with each other either directly or indirectly within the intracellular environment.

Bovine herpesvirus 1 (BHV-1) specifies and unspliced early 2.6-kb RNA (ER2.6) which is 3' coterminal with exon 2 of the 2.9-kb immediate-early (IE) RNA. The two transcripts have a common open reading frame (676 codons). The predicted protein, designated BHV-1 infected cell protein 0 (BICP0), contains a zinc finger domain with homology to ICP0 of herpes simplex virus type 1 and protein 61 of varicella-zoster virus, and depending on the promoter, it acts as a strong activator or as a repressor in transient expression assays. In situ immunoadsorbent assays using antisera against synthetic oligopeptides demonstrated that BICP0 accumulates in nuclei of BHV-1-infected cells, as expected for an IE gene product involved in gene regulation. Western blots (immunoblots) revealed a BHV-1-specific 97-kDa protein which was detectable during the IE phase and also at later periods of infection, indicating that the kinetics of BICP0 synthesis is consistent with the switch from IER2.9 to ER2.6. To confirm that ER2.6 encoded the 97-kDa BICP0 protein, a DNA fragment containing BICP0-coding sequences was inserted into the Autographa californica baculovirus genome. A recombinant protein, identified by its reactivity with antipeptide sera, exhibited the same electrophoretic mobility as BICP0 specified by BHV-1. We microinjected Xenopus oocytes with a BICP0 effector plasmid and a promoter-chloramphenicol acetyltransferase plasmid. BICP0-induced stimulation of this promoter was strongly reduced when intracellular zinc was chelated by thionein, indicating that the effect of BICP0 is zinc dependent.

Analysis of the promoter for the herpes simplex virus (HSV) immediate-early (alpha) gene alpha 0 in a short-term transient expression assay revealed that a SacI-to-NcoI fragment from -786 to +148 relative to the cap site directed the synthesis of chloramphenicol acetyltransferase when the fragment was present in either orientation. Although the constitutive levels of promoter activity were similar with either orientation, the reverse-orientation promoter was not induced in response to infection with HSV. Analysis of sequences composing the putative promoter in the opposite orientation revealed the presence of important regulatory elements associated with alpha promoters. These include an alpha-trans-inducing factor (alpha-TIF)-like response element, a high-affinity ICP4-binding site, numerous Sp1-binding sites, and a TATA box. Sequences contained within this region formed specific DNA-protein complexes in extracts from mock-infected and HSV-infected HeLa cells. Transient expression assays revealed that this sequence was positively regulated by the alpha 0 and alpha-TIF genes but negatively regulated by alpha 4. Finally, nuclear run-on transcription assays revealed that this promoter is active in its correct genomic context during the course of virus infection. We suggest that the promoter is a hybrid between an alpha and beta promoter because it exhibits maximal expression at 8 h postinfection and is expressed in the presence of cycloheximide.

The varicella-zoster virus (VZV) open reading frame 61 (ORF61) protein is thought to be the homolog of herpes simplex virus type 1 (HSV-1) ICP0, based on gene location and limited amino acid homology. However, HSV-1 ICP0 trans activates HSV-1 genes, while VZV ORF61 protein trans represses the function of VZV trans activators on VZV promoters in transient expression assays. To investigate the functional relatedness of HSV-1 ICP0 and VZV ORF61 protein, we established Vero and MeWo cell lines which stably express VZV ORF61 under the control of a metallothionein promoter and performed complementation studies with an HSV-1 ICP0 deletion mutant (7134). Mutant 7134 is impaired for plaque formation and replication at a low multiplicity of infection in cell culture, but these defects were complemented by up to 200-fold in Vero cell lines expressing VZV ORF61. Likewise, the efficiency of plaque formation was improved by up to 100-fold in MeWo cell lines expressing VZV ORF61. A cell line expressing another VZV immediate-early gene product (ORF62) was unable to complement mutant 7134. HSV-1 mutants which are deleted for other HSV-1 immediate-early gene products (ICP4, ICP27) were unable to grow in VZV ORF61-expressing cell lines. These results indicate that, despite marked differences in their sequences and in effects on their cognate promoters in transient expression assays, VZV ORF61 protein is the functional homolog of HSV-1 ICP0.

ICP0, a herpes simplex virus immediate-early gene product, is a highly phosphorylated nuclear protein that is a potent activator of virus and host genes. Using biochemical and genetic assays employing plasmids encoding mutant forms of ICP0 and a recombinant adenovirus that expresses ICP0, we mutant forms of ICP0 and a recombinant adenovirus that expresses ICP0, we provide evidence that the protein multimerizes. Some mutant forms of ICP0 were transdominant and interfered with activation of a target reporter gene or with complementation of an ICP0-minus virus.

Bovine herpesvirus 1 (BHV-1) contains three major immediate-early (IE) genes involved in regulation of the productive cycle of replication. Two spliced IE RNAs, IER4.2 (4.2 kb) and IER2.9 (2.9 kb), are under the control of a single promoter; IER1.7 (1.7 kb) is transcribed from a different promoter in the opposite direction. Examining the kinetics of transcription, we found that the IER4.2/2.9 promoter was turned off at the end of the IE period. An alternative promoter became active, directing synthesis of an unspliced early RNA, ER2.6 (2.6 kb), which was colinear with the second exon of IER2.9 except for its 5' end in the intron about 10 bases upstream of the splice site. Sequence analysis revealed a single open reading frame common to IER2.9 and ER2.6 with a coding potential of 676 amino acids. The putative protein, named p135, contained a cysteine-rich zinc finger domain near the N terminus with homology to ICP0 of herpes simplex virus type 1, to protein 61 of varicella-zoster virus, to early protein 0 of pseudorabies virus, and to other viral and cellular proteins. The remaining parts of p135 exhibited only limited homology, mainly with pseudorabies virus protein 0, but the entire sequence was highly conserved between two strains of BHV-1 (K22 and Jura). The latency-related antisense transcript covered a large portion of ER2.6 excluding the zinc finger coding region. In transient expression assays, p135 activated a variety of promoters, including that for ER2.6, but repressed the IER1.7 promoter. Thus, p135 combines functional characteristics of ICP0, a strong transactivator, and of protein 61, a repressor. BHV-1 seems to have evolved a subtle mechanism to ensure the continued synthesis of p135 while turning off IER4.2, which encodes p180, the herpes simplex virus type 1 ICP4 homolog.

Herpes simplex virus type 1 (HSV-1) mutants with codon insertions and deletions in IE-0, the gene encoding ICP0, were constructed. The HSV-1 deletion mutant dl1403 (N. D. Stow and E. C. Stow, J. Gen. Virol. 67:2571-2585, 1986) and an IE-0:lacZ transplacement vector isolated in this study were used to facilitate the construction of mutant viruses. Mutant viruses, all of which produced stable ICP0, were examined for their ability to plaque and grow on both Vero and HeLa cells because previous results showed that HSV-1 immediate-early (IE) gene promoters and their products are differentially expressed in these cells (J. Chen, X. Zhu, and S. Silverstein, Virology 180:207-220, 1991; I. H. Gelman and S. Silverstein, J. Virol. 61:2286-2296, 1987). Viruses with IE-0 genes that only poorly activated reporter genes in transient expression assays plaqued less efficiently on Vero cells and consistently accumulated decreased levels of late proteins. These mutants were also examined in single-step growth curve experiments and for the dependence of virus yield on multiplicity of infection (MOI). At low MOIs, their yields were less in Vero cells than in HeLa cells; by contrast, at high MOIs, there was no apparent difference in yield in either cell type, although each virus produced considerably fewer progeny than wild-type virus. Analysis of steady-state levels of RNA from genes representing each of the three major kinetic classes demonstrated that lower levels of RNAs accumulate in these mutants. We conclude from these studies that while ICP0 is not essential for virus growth in tissue culture, defects in this gene result in impairment of virus replication and delay the expression of early and late gene transcripts.

ICP0 is a 110,000-molecular-weight immediate-early protein of herpes simplex virus type 1 (HSV-1) which is encoded by three exons. It has been shown to function as a promiscuous transactivator of a variety of different HSV-1 and non-HSV-1 promoters in transient expression assays. Analysis of mutations which truncated the carboxy-terminal end of this 775-amino-acid (aa) protein demonstrated that a polypeptide which contained only aa 1 to 553 still possessed significant transactivation potential. Additional carboxy-terminal truncations which sequentially removed aa 245 to 553 and thus the remainder of the third exon resulted in the eventual loss of transactivation capability in these mutants. However, further analysis of these truncated derivatives demonstrated that they behaved as dominant-negative mutants to the wild-type polypeptide. Moreover, one of the mutants was found to act as a promiscuous repressor, in that it could dramatically inhibit a variety of HSV-1 promoters, non-HSV-1 promoters, and heterologous transactivator proteins in transient expression assays, despite having lost almost the entire third exon. These results indicate that a domain encoded by the first two exons probably interacts with, and can effectively titrate, the unknown cellular factor(s) through which ICP0 mediates transactivation.

The time course of accumulation of herpes simplex virus immediate-early (IE) mRNA and the requirement for infected cell protein synthesis for mRNA transcription and accumulation were compared. Measurements of transcription in nuclear run-on assays, accumulation of cytoplasmic mRNA by Northern (RNA) blot hybridization, and rates of infected cell protein synthesis by pulse-labeling did not indicate differences among the five IE gene, consistent with previous studies. However, as a result of varying the amount of de novo protein synthesis after infection, at least three patterns of maximal expression of the IE genes were revealed. Addition of the protein synthesis inhibitor anisomycin to cells coincident with infection resulted in maximal rates of transcription and accumulation of functional ICP0 mRNA, while 0.5 h of infected cell protein synthesis prior to addition of the drug was required for maximal expression of ICP22/47 and ICP27 mRNAs. Maximal expression of ICP4 mRNA occurred only when 1 h of de novo protein synthesis occurred prior to the addition of the drug. These results are discussed in the context of alternative mechanisms for regulating IE gene expression.

Vaccinia virus recombinants containing the sequences from herpes simplex virus type 1 (HSV-1) encoding the immediate early (IE)(alpha) proteins ICP4 and ICP0, under the control of a mutated vaccinia virus 11K late promoter, were constructed. A cDNA copy of the gene encoding ICPO and an ICP4-encoding genomic segment were each inserted into the vaccinia virus genome at the thymidine kinase (TK) locus by homologous recombination. Steady-state analyses revealed that RNAs homologous to the IE-0 and IE-4 sequences accumulated in cells infected by recombinants with the kinetics of a typical vaccinia late mRNA. Western blot analyses demonstrated that the expression level of both ICPO and ICP4, produced by the recombinant viruses, was comparable to that in HSV-1-infected cells at late times postinfection. Both proteins synthesized in cells infected by the recombinants were located in the nucleus as revealed by immunofluorescence. Although in vitro studies reveal that extracts from vaccinia-virus-infected cells lose the ability to transcribe genes that contain RNA polymerase II promoters (Puckett and Moss (1983), Cell 35, 441-448) both ICPO and ICP4 expressed by the recombinant viruses can transactivate plasmids containing a reporter gene driven by the promoters for the HSV-1 TK and glycoprotein C genes. Nuclear extracts prepared from cells infected with the vaccinia virus vector expressing ICP4 exhibited sequence-specific DNA-binding activity.