Integrative transcriptomic and proteomic analysis reveals that SERPING1 inhibits neuronal proliferation via the CaMKII-CREB-BDNF pathway in schizophrenia

Table 1 Clinical information of schizophrenia used in the Omics analysis

SZ	Case 1	Case 2	Case 3	Case 4	Case 5	Case 6
Gender	Male	Male	Male	Female	Female	Female
Age	36	25	19	16	29	36
Age of onset	24	19	17	15	20	28
Disease classification	Undifferentiated type	Undifferentiated type	Paranoid type	Undifferentiated type	Paranoid type	Undifferentiated type
Family history	No	No	No	No	No	No
Imaging examination	Abnormal	Abnormal	Normal	Abnormal	Normal	Normal

Healthy controls, matched for age and gender with the Schizophrenia group, was included during the same period. SZ: Schizophrenia.

Table 2 Real-time fluorescence quantitative PCR primer information

ID	Forward primer (5'- > 3')	Reverse primer (5'- > 3')
GAPDH	TGTTCGTCATGGGTGTGAAC	ATGGCATGGACTGTGGTCAT
HP	AATGTGAAGCAGATGACGGC	GATCCCAGTCGCATACCAGG
LTF	TTGTCTTCCTCGTCCTGCTG	GGGAGCCAAAGAGCTGGAAT
SEEPING1	CTCCTACCCAGCCCACTACT	CCAAGTTGGCGTCACTGTTG

HP: Haptoglobin; LTF: Lactotransferrin.

Table 3 The information of RNAi target

RNAi target	Target sequence
SEEPING1-sh1	ACACTGTTTTGCAGCTTTTAT
SEEPING1-sh2	AACCAGTGGATCCACCAAAAT
SEEPING1-sh3	AGTCTTCATGGGCCGTGTATA

Table 4 Differential gene expression statistics

Gene_id	Symbol	Disease_read count	Normal_read count	Log2FC	P-adj
ENSG00000107643	MAPK8	2141.92	980.48	1.1278	1.63E-36
ENSG00000108691	CCL2	965.58	14.1	6.0888	1.04E-31
ENSG00000169439	SDC2	726.54	12.05	5.9209	8.61E-31
ENSG00000160460	SPTBN4	100.36	16.26	2.626	3.57E-27
ENSG00000088899	LZTS3	436.07	138.93	1.6541	3.95E-24
ENSG00000095794	CREM	1760.64	355.27	2.3089	2.31E-23
ENSG00000144749	LRIG1	1648.48	755.18	1.127	2.46E-22
ENSG00000171793	CTPS1	1093.29	384.58	1.5064	1.08E-21
ENSG00000176641	RNF152	182.81	8.89	4.3723	5.64E-20
ENSG00000260196	-	163.81	50.63	1.6952	6.05E-19

Displayed as the top 10 genes with up-regulated expression.

Table 5 The information of significantly differentially expressed genes

Gene_id	DEGs	Protein_id	Protein_log2FC	Gene_log2FC
ENSG00000257017	HP	P00738	2.449962325	1.4294
ENSG00000012223	LTF	P02788	2.077758566	3.3348
ENSG00000091513	TF	P02787	1.587407166	-1.0837
ENSG00000149131	SERPING1	P05155	1.538266732	1.4989
ENSG00000125730	C3	P01024	1.428640888	1.0951
ENSG00000106804	C5	P01031	1.176272232	-1.0651
ENSG00000197249	SERPINA1	P01009	1.13095551	1.5216
ENSG00000177697	CD151	P48509	0.89951464	1.0137
ENSG00000122862	SRGN	P10124	0.77902409	1.4672
ENSG00000124762	CDKN1A	P38936	0.760160059	1.8984
ENSG00000079308	TNS1	Q9HBL0	0.745846947	2.6092
ENSG00000137507	LRRC32	Q14392	0.722864535	1.7123
ENSG00000064651	SLC12A2	P55011	0.716578449	1.4223
ENSG00000138448	ITGAV	P06756	0.706188096	1.4381
ENSG00000108405	P2RX1	P51575	0.662687029	1.6951
ENSG00000145685	LHFPL2	Q6ZUX7	0.662220906	3.638
ENSG00000151327	FAM177A1	Q8N128	0.640431398	1.0575
ENSG00000173083	HPSE	Q9Y251	0.620238989	1.8333
ENSG00000139970	RTN1	Q16799	0.601847201	-1.2624
ENSG00000235194	PPP1R3E	Q9H7J1	0.597450245	-1.0182
ENSG00000204390	HSPA1 L	P34931	0.593410635	-1.1346
ENSG00000108175	ZMIZ1	Q9ULJ6	-0.587965548	1.3241
ENSG00000166965	RCCD1	A6NED2	-0.613166445	-1.0529
ENSG00000139193	CD27	P26842	-0.730964915	-1.2033
ENSG00000168310	IRF2	P14316	-0.940903659	-1.239

DEGs: Differentially expressed genes.