Alzheimer's disease (AD) is a type of neurodegenerative illness in which β-amyloid (Aβ) and tau protein accumulate in neurons in the form of tangles. The pathophysiological pathway of AD consists of Aβ-amyloid peptides, tau proteins, and oxidative stress in neurons and increased neuro-inflammatory response. Food and Drug Administration in the United States has authorized various drugs for the effective treatment of AD, which include galantamine, rivastigmine, donepezil, memantine, sodium oligomannate, lecanemab, and aducanumab. The major disadvantage of these drugs is that they only provide "symptomatic" relief. They are most effective in the early stages or for mild to moderate cases of the disease, but are not suitable for long-term use. Besides conventional therapies, phytochemicals have the potential to stop the progression of AD. According to research, the use of potential phytochemicals against AD has gained attention due to their potent anti-inflammatory, antioxidant, anti-hyperphosphorylation of the tau protein, metal chelation, and anti-amyloid properties. This study seeks to provide an up-to-date compilation of the most current and promising breakthroughs in AD therapy using phytochemicals. It could be concluded that phytochemicals light serve as an effective therapy for AD. However, more mechanistic investigations are needed to determine the clinical implications of phytochemicals in AD treatment.

Alzheimer's disease (AD) is a severe neurodegenerative disease characterized mainly by the formation of amyloid beta (Aβ) plaques and abnormal phosphorylation of tau. In recent years, an imbalance in iron homeostasis has been recognized to play a key role in the pathological process of AD. Abnormal iron accumulation can activate various kinases such as glycogen synthase kinase-3β, cyclin-dependent kinase 5, and mitogen-activated protein kinase, leading to abnormal phosphorylation of tau and amyloid precursor protein, and accelerating the formation of Aβ plaques and neurofibrillary tangles. In addition, iron-mediated oxidative stress not only triggers neuronal damage, but also exacerbates neuronal dysfunction by altering the phosphorylation of N-methyl-D-aspartate receptors and γ-aminobutyric acid type A receptors. Iron accumulation also affects the phosphorylation status of tyrosine hydroxylase, the rate-limiting enzyme for dopamine synthesis, interfering with the dopamine signaling pathway. On the other hand, iron affects iron transport and metabolism in the brain by regulating the phosphorylation of transferrin, further disrupting iron homeostasis. Therapeutic strategies targeting iron metabolism show promise by reducing iron accumulation, inhibiting oxidative stress, and reducing abnormal phosphorylation of key proteins. This article reviews the molecular mechanisms of phosphorylation modifications mediated by iron homeostasis imbalance in AD, and discusses the potential of interventions that regulate iron metabolism and related signaling pathways, providing a new theoretical basis for the treatment of AD.

Magnetic nanoparticles (MNPs) are highly versatile nanomaterials in nanomedicine, owing to their diverse magnetic properties, which can be tailored through variations in size, shape, composition, and exposure to inductive magnetic fields. Over four decades of research have led to the clinical approval or ongoing trials of several MNP formulations, fueling continued innovation. Beyond traditional applications in drug delivery, imaging, and cancer hyperthermia, MNPs have increasingly advanced into molecular medicine. Under external magnetic fields, MNPs can generate mechano- or thermal stimuli to modulate individual molecules or cells deep within tissue, offering precise, remote control of biological processes at cellular and molecular levels. These unique capabilities have opened new avenues in emerging fields such as genome editing, cell therapies, and neuroscience, underpinned by a growing understanding of nanomagnetism and the molecular mechanisms responding to mechanical and thermal cues. Research on MNPs as a versatile synthetic material capable of engineering control at the cellular and molecular levels holds great promise for advancing the frontiers of molecular medicine, including areas such as genome editing and synthetic biology. This review summarizes recent clinical studies showcasing the classical applications of MNPs and explores their integration into molecular medicine, with the goal of inspiring the development of next-generation MNP-based platforms for disease treatment.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22 cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

As essential micronutrients, metal ions such as iron, manganese, copper, and zinc, are required for a wide range of physiological processes in the brain. However, an imbalance in metal ions, whether excessive or insufficient, is detrimental and can contribute to neuronal death through oxidative stress, ferroptosis, cuproptosis, cell senescence, or neuroinflammation. These processes have been found to be involved in the pathological mechanisms of neurodegenerative diseases. In this review, the research history and milestone events of studying metal ions, including iron, manganese, copper, and zinc in neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD), will be introduced. Then, the upstream regulators, downstream effector, and crosstalk of mental ions under both physiologic and pathologic conditions will be summarized. Finally, the therapeutic effects of metal ion chelators, such as clioquinol, quercetin, curcumin, coumarin, and their derivatives for the treatment of neurodegenerative diseases will be discussed. Additionally, the promising results and limitations observed in clinical trials of these metal ion chelators will also be addressed. This review will not only provide a comprehensive understanding of the role of metal ions in disease development but also offer perspectives on their modulation for the prevention or treatment of neurodegenerative diseases.

Neurodegenerative disorders, such as Alzheimer's and Parkinson's diseases, share key characteristics, notably cognitive impairment and significant cell death in specific brain regions. Cognition, a complex mental process allowing individuals to perceive time and place, is disrupted in these conditions. This consistent disruption suggests the possibility of a shared underlying mechanism across all neurodegenerative diseases. One potential common factor is the activation of pathways leading to cell death. Despite significant progress in understanding cell death pathways, no definitive treatments have emerged. This has shifted focus towards less-explored mechanisms like ferroptosis, which holds potential due to its involvement in oxidative stress and iron metabolism. Unlike apoptosis or necrosis, ferroptosis offers a novel therapeutic avenue due to its distinct biochemical and genetic underpinnings, making it a promising target in neurodegenerative disease treatment. Ferroptosis is distinguished from other cellular death mechanisms, by distinctive characteristics such as an imbalance of iron hemostasis, peroxidation of lipids in the plasma membrane, and dysregulated glutathione metabolism. In this review, we discuss the potential role of ferroptosis in cognitive impairment. We then summarize the evidence linking ferroptosis biomarkers to cognitive impairment brought on by neurodegeneration while highlighting recent advancements in our understanding of the molecular and genetic mechanisms behind the condition. Finally, we discuss the prospective therapeutic implications of targeting ferroptosis for the treatment of cognitive abnormalities associated with neurodegeneration, including natural and synthetic substances that suppress ferroptosis via a variety of mechanisms. Promising therapeutic candidates, including antioxidants and iron chelators, are being explored to inhibit ferroptosis and mitigate cognitive decline.

Iron plays a prominent role in various biological processes and is an essential element in almost all organisms, including plant-pathogenic fungi. As a transition element, iron occurs in two redox states, Fe2+ and Fe3+, the transition between which generates distinct reactive oxygen species (ROS) such as H2O2, OH- anions, and toxic OH· radicals. Thus, the redox status of Fe determines ROS formation in pathogen attack and plant defense and governs the outcome of pathogenic interactions. Therefore, spatially resolved visualization of Fe2+ and Fe3+ are essential to understand microbial pathogenesis. Here, we report a simple method for synthesis of the redox-state-selective dyes pyrene-tetramethyl piperidinyl oxyl (p-TEMPO) and 4-(4-methylpiperazine-1)-7-nitrobenz-2-oxa-1,3-diazole (MPNBD) for fluorescence microscopy-based imaging of Fe2+ and Fe3+ ions. Using these dyes, the occurrence and spatial distribution of Fe2+ and Fe3+ ions in vegetative and pathogenic hyphae of the hemibiotrophic maize anthracnose fungus Colletotrichum graminicola are shown. [Formula: see text] Copyright © 2025 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Alzheimer's disease is a devastating neurodegenerative disorder that affects millions of people worldwide. One of the key pathological features of Alzheimer's disease is oxidative stress, which is characterized by an imbalance between the production of reactive oxygen species and the body's ability to neutralize them with antioxidants. In recent years, there has been growing interest in the potential role of antioxidant supplementation in mitigating oxidative stress markers in Alzheimer's disease. This review paper aims to provide a comprehensive overview of the current research on antioxidant supplementation in Alzheimer's disease and its effects on oxidative stress markers. The paper will examine the underlying mechanisms of oxidative stress in Alzheimer's disease, the potential benefits of antioxidant supplementation, and the challenges and limitations of using antioxidants as a therapeutic strategy.

Spontaneous cleavage reactions normally occur in vivo on amino acid peptide backbones, leading to fragmentation products that can have different physiological roles and toxicity, particularly when the substrate of the hydrolytic processes are neuronal peptides and proteins highly related to neurodegeneration. We report a hydrolytic study performed with the HPLC-MS technique at different temperatures (4 °C and 37 °C) on peptide fragments of different neuronal proteins (amyloid-β, tau, and α-synuclein) in physiological conditions in the presence of Cu2+ and Zn2+ ions, two metal ions found at millimolar concentrations in amyloid plaques. The coordination of these metal ions with these peptides significantly protects their backbones toward hydrolytic degradation, preserving the entire sequences over two weeks in solution, while the free peptides in the same buffer are fully fragmented after the same or even shorter incubation period. Our data show that peptide cleavage is not only ruled by the chemical sensitivity of amino acids, but the peptide conformation changes induced by metal coordination influence hydrolytic reactions. The enhanced stability of neuronal peptides provided by metal coordination can increase local levels of amyloidogenic species capable of seeding fibril growth, resulting in aberrant protein depositions and deficits in neuronal activity.

Rampant phospholipid peroxidation initiated by iron causes ferroptosis unless this is restrained by cellular defences. Ferroptosis is increasingly implicated in a host of diseases, and unlike other cell death programs the physiological initiation of ferroptosis is conceived to occur not by an endogenous executioner, but by the withdrawal of cellular guardians that otherwise constantly oppose ferroptosis induction. Here, we profile key ferroptotic defence strategies including iron regulation, phospholipid modulation and enzymes and metabolite systems: glutathione reductase (GR), Ferroptosis suppressor protein 1 (FSP1), NAD(P)H Quinone Dehydrogenase 1 (NQO1), Dihydrofolate reductase (DHFR), retinal reductases and retinal dehydrogenases (RDH) and thioredoxin reductases (TR). A common thread uniting all key enzymes and metabolites that combat lipid peroxidation during ferroptosis is a dependence on a key cellular reductant, nicotinamide adenine dinucleotide phosphate (NADPH). We will outline how cells control central carbon metabolism to produce NADPH and necessary precursors to defend against ferroptosis. Subsequently we will discuss evidence for ferroptosis and NADPH dysregulation in different disease contexts including glucose-6-phosphate dehydrogenase deficiency, cancer and neurodegeneration. Finally, we discuss several anti-ferroptosis therapeutic strategies spanning the use of radical trapping agents, iron modulation and glutathione dependent redox support and highlight the current landscape of clinical trials focusing on ferroptosis.

Iron-mediated cell death (ferroptosis) is a proposed mechanism of Alzheimer's disease (AD) pathology. While iron is essential for basic biological functions, its reactivity generates oxidants which contribute to cell damage and death.

To further resolve mechanisms of iron-mediated toxicity in AD, we analyzed post mortem human brain and ApoEFAD mice.

AD brains had decreased antioxidant enzymes, including those mediated by glutathione (GSH). Subcellular analyses of AD brains showed greater oxidative damage and lower antioxidant enzymes in lipid rafts, the site of amyloid processing, than in the non-raft membrane fraction. Apolipoprotein E ε4 carriers had lower lipid raft yield with greater membrane oxidation. The hypothesized role of iron in AD pathology was tested in ApoEFAD mice by iron chelation with deferoxamine, which decreased fibrillar amyloid and lipid peroxidation, together with increased GSH-mediated antioxidants.

These novel molecular pathways highlight iron-mediated damage to lipid rafts during AD.

Alzheimer's disease (AD) brains have numerous markers for ferroptosis, including increased lipid peroxidation, reduced antioxidant levels, and increased iron storage. Lipid rafts in AD cases have increased oxidative damage and reduced antioxidant enzyme levels and activity which are most severe in apolipoprotein E ε4 carriers. Neuronal markers are correlated with lipid peroxidation, antioxidant defense, and iron signaling proteins suggesting that neuronal loss is linked to these events. Chelation of iron in the early-onset familial AD model reduces iron-mediated lipid peroxidation and fibrillar amyloid.

Interventions that substantially slow neurodegeneration are needed to address the growing burden of Alzheimer disease (AD) to societies worldwide. Elevated brain iron observed in AD has been associated with accelerated cognitive decline and may be a tractable drug target.

To investigate whether the brain-permeable iron chelator deferiprone slows cognitive decline in people with AD.

This phase 2, double-masked, placebo-controlled randomized clinical trial of 12-month duration was conducted at 9 sites in Australia between August 2, 2018, and April 1, 2023. Patients older than 54 years with amyloid-confirmed mild cognitive impairment or early AD (a Mini-Mental State Examination score of 20 or higher) were screened. Randomization was 2:1 and masked to participants and all study staff.

Deferiprone 15 mg/kg twice a day or placebo administered orally for 12 months.

The primary outcome was a composite cognitive measure assessed at baseline, 6 months, and 12 months using a neuropsychological test battery (NTB) of memory, executive function, and attention tasks. Secondary outcomes included change in brain iron burden measured by quantitative susceptibility mapping (QSM) magnetic resonance imaging (target engagement), brain volume changes (secondary efficacy measure), and adverse events (safety analysis).

Of 167 patients screened for eligibility, 81 were included, with 53 randomly assigned to the deferiprone group (mean [SD] age, 73.0 [8.0] years; 29 male [54.7%]) and 28 to the placebo group (mean [SD] age, 71.6 [7.2] years; 17 male [60.7%]); 54 participants completed the study (7 [25.0%] withdrew from the placebo group and 20 [37.7%] from the deferiprone group). In an intention-to-treat analysis, participants in the deferiprone group showed accelerated cognitive decline on the NTB primary outcome (β for interaction = -0.50; 95% CI, -0.80 to -0.20) compared with placebo (change in NTB composite z score for deferiprone, -0.80 [95% CI, -0.98 to -0.62]; for placebo, -0.30 [95% CI, -0.54 to -0.06]). Secondary analysis revealed that this result was driven by worsening performance on executive function tests. The QSM confirmed that deferiprone decreased iron in the hippocampus compared with placebo (change in hippocampal QSM for deferiprone, -0.36 ppb [95% CI, -0.76 to 0.04 ppb]; for placebo, 0.32 ppb [95% CI, -0.12 to 0.75 ppb]; β for interaction = -0.68 [95% CI, -1.27 to -0.09]). Longitudinal hippocampal volume loss was not affected by deferiprone, but exploratory analysis of other brain regions revealed increased volume loss with deferiprone in frontal areas. The frequency of the adverse effect of neutropenia (4 participants [7.5%] in the deferiprone group) was higher than in similar studies (1.6%-4.4%).

These trial findings show that deferiprone 15 mg/kg twice a day decreased hippocampal QSM and accelerated cognitive decline in patients with amyloid-confirmed early AD, suggesting that lowering iron with deferiprone is detrimental to patients with AD.

ClinicalTrials.gov Identifier: NCT03234686.

Neuritic plaques are pathognomonic and terminal lesions of Alzheimer disease (AD). They embody AD pathogenesis because they harbor in one space critical pathologic features of the disease: amyloid deposits, neurofibrillary degeneration, neuroinflammation, and iron accumulation. Neuritic plaques are thought to arise from the conversion of diffuse extracellular deposits of amyloid-β protein (Aβ), and it is believed that during conversion, amyloid toxicity creates the dystrophic neurites of neuritic plaques, as well as neurofibrillary tangles However, recent evidence from human postmortem studies suggests a much different mechanism of neuritic plaque formation, where the first step in their creation is neuronal degeneration driven by iron overload and ferroptosis. Similarly, neurofibrillary tangles represent the corpses of iron-laden neurons that develop independently of Aβ deposits. In this review, we will focus on the role of free redox-active iron in the development of typical AD pathology, as determined largely by evidence obtained in the human temporal lobe during early, preclinical stages of AD. The findings have allowed the construction of a scheme of AD pathogenesis where brain iron is center stage and is involved in every step of the sequence of events that produce characteristic AD pathology. We will discuss how the study of preclinical AD has produced a fresh and revised assessment of AD pathogenesis that may be important for reconsidering current therapeutic efforts and guiding future ones. SIGNIFICANCE STATEMENT: This review offers a novel perspective on Alzheimer disease pathogenesis where elevated brain iron plays a central role and is involved throughout the development of lesions. Herein, we review arguments against the amyloid cascade theory and explain how recent findings in humans during early preclinical disease support iron-mediated cell death and endogenous iron containment mechanisms as critical components of neuritic plaque formation and ensuing dementia.

Late-onset Alzheimer's disease (LOAD) is a chronic, multifactorial, and progressive neurodegenerative disease that associates with aging and is highly prevalent in our older population (≥65 years of age). This hypothesis generating this narrative review will examine the important role for the use of sodium thiosulfate (STS) as a possible multi-targeting treatment option for LOAD. Sulfur is widely available in our environment and is responsible for forming organosulfur compounds that are known to be associated with a wide range of biological activities in the brain. STS is known to have (i) antioxidant and (ii) anti-inflammatory properties; (iii) chelation properties for calcium and the pro-oxidative cation metals such as iron and copper; (iv) donor properties for hydrogen sulfide production; (v) possible restorative properties for brain endothelial-cell-derived bioavailable nitric oxide. Thus, it becomes apparent that STS has the potential for neuroprotection and neuromodulation and may allow for an attenuation of the progressive nature of neurodegeneration and impaired cognition in LOAD. STS has been successfully used to prevent cisplatin oxidative-stress-induced ototoxicity in the treatment of head and neck and solid cancers, cyanide and arsenic poisoning, and fungal skin diseases. Most recently, intravenous STS has become part of the treatment plan for calciphylaxis globally due to vascular calcification and ischemia-induced skin necrosis and ulceration. Side effects have been minimal with reports of metabolic acidosis and increased anion gap; as with any drug treatment, there is also the possibility of allergic reactions, possible long-term osteoporosis from animal studies to date, and minor side-effects of nausea, headache, and rhinorrhea if infused too rapidly. While STS poorly penetrates the intact blood-brain barrier(s) (BBBs), it could readily penetrate BBBs that are dysfunctional and disrupted to deliver its neuroprotective and neuromodulating effects in addition to its ability to penetrate the blood-cerebrospinal fluid barrier of the choroid plexus. Novel strategies such as the future use of nano-technology may be helpful in allowing an increased entry of STS into the brain.

Alzheimer's disease (AD) is one of the most common neurodegenerative disorders, characterized by the slow and progressive loss of brain structure and function, primarily affecting older individuals. Evidence has shown that disruption of zinc homeostasis in the brain contributes to synaptic dysfunction, as well as impairments in learning and memory. In this study, we evaluated the effect of zeolite zinc on memory performance and hippocampal cell death in a rat model of Alzheimer's disease (AD) induced by intracerebroventricular administration of Aβ1-42. We employed the Morris water maze, shuttle box, and open field tests to assess spatial memory, passive avoidance memory, and anxiety-like behavior, respectively. P-Tau and the amyloid precursor protein (APP) expression, along with hippocampal cell death, were also evaluated. Both Aβ1-42 and zeolite zinc were injected intracerebroventricularly. The results showed that zeolite zinc partially reversed Aβ1-42-induced impairments in memory performance and mitigated the effects of Aβ1-42 on locomotor activity, although it did not fully restore baseline levels. In addition, Aβ1-42 increased the expression of APP and P-Tau, as well as the number of dead cells, whereas zeolite zinc reduced these effects. In conclusion, our findings suggest that while zeolite zinc plays a role in modulating the pathophysiology of AD, its therapeutic effects only partially reverse the progression or symptoms of AD, indicating the need for further investigation into optimal dosing or combination therapies.

Iron is crucial for brain function, but excessive iron is neurotoxic. Abnormally high brain iron accumulation is one of the pathogenic factors in Alzheimer's disease (AD). Therefore, understanding the mechanistic basis of iron dyshomeostasis in AD is vital for disease mitigation. Calcium, another essential bioelement involved in cell signaling, also exhibits dysregulated homeostasis in AD. Calcium ion (Ca2+) signaling can influence iron homeostasis through multiple effectors. Our previous studies identified Ca2+/calmodulin (CAM)-dependent protein kinase kinase 2 (CAMKK2) as a regulator of transferrin (TF)-bound iron trafficking through the TF receptor (TFRC). Given CAMKK2's high expression in brain cells, it was hypothesized that abnormal CAMKK2-TF/TFRC signaling may underlie excessive iron deposition in AD brains. This study aims to retrospectively investigate CAMKK2, TF, TFRC proteins, and iron content in temporal cortex tissues from AD patients and cognitively normal (CN) individuals, postmortem.

Postmortem temporal cortex tissues from 74 AD patients, 27 Parkinson's disease (PD) patients, and 17 CN individuals were analyzed for CAMKK2, TF, and TFRC protein levels by Western blotting. Additionally, prefrontal/temporal cortex tissues from 30 CN individuals of various ages were examined for age-related effects. Iron content in cortical tissues was measured using a colorimetric assay.

CAMKK2, TF, and TFRC levels were significantly decreased in AD patients' temporal cortices compared to CN individuals, independent of age or postmortem interval-related changes. PD patients' also exhibited similar reductions in CAMKK2/TF/TFRC levels. The increased iron content in AD brains was significantly correlated with reduced TF/TFRC protein levels.

Building on the previous identification of CAMKK2 as a regulator of TF/TFRC trafficking and iron homeostasis, the findings from this study suggest that downregulation of CAMKK2 in AD cortices may disrupt TF/TFRC signaling and contribute to iron overloading and neurodegeneration through iron-induced toxicity. The decreased levels of TF/TFRC and increased iron in AD brains may result from enhanced clearance or post-trafficking degradation of TF/TFRC due to CAMKK2 downregulation. Restoring CAMKK2 levels in the AD brain could offer a novel therapeutic approach to reestablish iron homeostasis. Further studies are needed to explore the pathways linking CAMKK2 and iron dysregulation in AD and other neurodegenerative diseases.

Heme, a complex iron-containing molecule, is traditionally recognized for its pivotal role in oxygen transport and cellular respiration. However, emerging research has illuminated its multifaceted functions in the nervous system, extending beyond its canonical roles. This review delves into the diverse roles of heme in the nervous system, highlighting its involvement in neural development, neurotransmission, and neuroprotection. We discuss the molecular mechanisms by which heme modulates neuronal activity and synaptic plasticity, emphasizing its influence on ion channels and neurotransmitter receptors. Additionally, the review explores the potential neuroprotective properties of heme, examining its role in mitigating oxidative stress, including mitochondrial oxidative stress, and its implications in neurodegenerative diseases. Furthermore, we address the pathological consequences of heme dysregulation, linking it to conditions such as Alzheimer's disease, Parkinson's disease, and traumatic brain injuries. By providing a comprehensive overview of heme's multifunctional roles in the nervous system, this review underscores its significance as a potential therapeutic target and diagnostic biomarker for various neurological disorders.

Few studies have considered nutrients as a mixture and their impact on Mild Cognitive Impairment (MCI). The generalized linear regression (GLM), weighted quantile sum (WQS) regression, and Bayesian kernel machine regression (BKMR) models are fitted to estimate the association between intake of a mixture of nutrients and MCI. Comparing the results from these three models, vitamin E and vitamin B6 were identified as the most important factors associated with the risk of MCI. Considering the characteristics of BKMR, it may be more advantageous to use BKMR to estimate the combined the joint effects of nutrients mixture. In the future, studies need to move from a "one nutrient at a time" approach to simultaneous analyses of multiple nutrients intakes in order to understand and quantify the joint effect of nutrients mixture on health.

Iron is critical for neuronal activity and metabolism, and iron dysregulation alters these functions in age-related neurodegenerative disorders, such as Alzheimer's disease (AD). AD is a chronic neurodegenerative disease characterized by progressive neuronal dysfunction, memory loss and decreased cognitive function. AD patients exhibit elevated iron levels in the brain compared to age-matched non-AD individuals. However, the degree to which iron overload contributes to AD pathogenesis is unclear. Here, we evaluated the involvement of ferroptosis, an iron-dependent cell death process, in mediating AD-like pathologies in C. elegans. Results showed that iron accumulation occurred prior to the loss of neuronal function as worms age. In addition, energetic imbalance was an early event in iron-induced loss of neuronal function. Furthermore, the loss of neuronal function was, in part, due to increased mitochondrial reactive oxygen species mediated oxidative damage, ultimately resulting in ferroptotic cell death. The mitochondrial redox environment and ferroptosis were modulated by pharmacologic processes that exacerbate or abolish iron accumulation both in wild-type worms and worms with increased levels of neuronal amyloid beta (Aβ). However, neuronal Aβ worms were more sensitive to ferroptosis-mediated neuronal loss, and this increased toxicity was ameliorated by limiting the uptake of ferrous iron through knockout of divalent metal transporter 1 (DMT1). In addition, DMT1 knockout completely suppressed phenotypic measures of Aβ toxicity with age. Overall, our findings suggest that iron-induced ferroptosis alters the mitochondrial redox environment to drive oxidative damage when neuronal Aβ is overexpressed. DMT1 knockout abolishes neuronal Aβ-associated pathologies by reducing neuronal iron uptake.

Alzheimer's disease (AD) is a devastating kind of dementia that is becoming more common worldwide. Toxic amyloid-beta (Aβ) aggregates are the primary cause of AD onset and development. Superparamagnetic iron oxide nanoparticles (SPIONs) have received a lot of interest in AD therapy over the last decade because of their ability to redirect the Aβ fibrillation process and improve associated brain dysfunction. The potential diagnostic application of SPIONs in AD has dramatically increased this interest. Furthermore, surface-modified engineered SPIONs function as drug carriers to improve the efficacy of current therapies. Various preclinical and clinical studies on the role of SPIONs in AD pathology have produced encouraging results. However, due to their physicochemical properties (e.g., size, surface charge, and particle concentration) in the biological milieu, SPIONs may play the role of a preventive or accelerative agent in AD. Even though SPIONs are potential therapeutic and diagnostic options in AD, significant efforts are still needed to overcome the inconsistencies and safety concerns. This review evaluated the current understanding of how various SPIONs interact with AD models and explored the discrepancies in their efficacy and safety.

Renal aging, marked by the accumulation of senescent cells and chronic low-grade inflammation, leads to renal interstitial fibrosis and impaired function. In this study, we investigate the role of macrophages, a key regulator of inflammation, in renal aging by analyzing kidney single-cell RNA sequencing data of C57BL/6J mice from 8 weeks to 24 months. Our findings elucidate the dynamic changes in the proportion of kidney cell types during renal aging and reveal that increased macrophage infiltration contributes to chronic low-grade inflammation, with these macrophages exhibiting senescence and activation of ferroptosis signaling. CellChat analysis indicates enhanced communications between macrophages and tubular cells during aging. Suppressing ferroptosis alleviates macrophage-mediated tubular partial epithelial-mesenchymal transition in vitro, thereby mitigating the expression of fibrosis-related genes. Using SCENIC analysis, we infer Stat1 as a key age-related transcription factor promoting iron dyshomeostasis and ferroptosis in macrophages by regulating the expression of Pcbp1, an iron chaperone protein that inhibits ferroptosis. Furthermore, through virtual screening and molecular docking from a library of anti-aging compounds, we construct a docking model targeting Pcbp1, which indicates that the natural small molecule compound Rutin can suppress macrophage senescence and ferroptosis by preserving Pcbp1. In summary, our study underscores the crucial role of macrophage iron dyshomeostasis and ferroptosis in renal aging. Our results also suggest Pcbp1 as an intervention target in aging-related renal fibrosis and highlight Rutin as a potential therapeutic agent in mitigating age-related renal chronic low-grade inflammation and fibrosis.

Alzheimer's disease (AD) is a neurodegenerative disease that is characterized by amyloid plaques, neurofibrillary tangles, and neuronal loss. Early cerebral and body iron dysregulation and accumulation interact with AD pathology, particularly in the precuneus, a crucial functional hub in cognitive functions. Quantitative susceptibility mapping (QSM), a novel post-processing approach, provides insights into tissue iron levels and cerebral oxygen metabolism and reveals abnormal iron accumulation early in AD. Increased iron deposition in the precuneus can lead to oxidative stress, neuroinflammation, and accelerated neurodegeneration. Metabolic disorders (diabetes, non-alcoholic fatty liver disease (NAFLD), and obesity), genetic factors, and small vessel pathology contribute to abnormal iron accumulation in the precuneus. Therefore, in line with the growing body of literature in the precuneus region of patients with AD, QSM as a neuroimaging method could serve as a non-invasive biomarker to track disease progression, complement other imaging modalities, and aid in early AD diagnosis and monitoring.

The objective of the current study is to develop a new method for tracking transplanted human induced pluripotent stem cells-derived cardiomyocytes (hiPSC-CMs) using magnetic resonance imaging (MRI). The CRISPR/dCas9 activation system is employed to overexpress ferritin heavy chain (FHC) in hiPSC-CMs. The mRNA and protein expression of FHC in hiPSC and hiPSC-CMs significantly increased after transfection. Iron chloride does not affect the cell viability in a concentration range from 0 to 2000 µm. hiPSCs overexpressing FHC (hiPSC- FHCOE) and hiPSC-CMs overexpressing FHC (hiPSC-CM-FHCOE) significantly enhanced cellular uptake of iron chloride but with no changes in electrophysiological properties compared to hiPSC-CM-Control. Furthermore, hiPSC-CM-FHCOE presented robust contrast and lower T2* values, signifying their potential as highly effective candidates for cardiac MRI. Next, hiPSC-CM-FHCOE is injected into mouse hearts and after 3 days of transplantation, MR images are obtained. hiPSC-CM-FHCOE cells exhibited clear signals in the hearts with lower T2* and rapid signal decay. Collectively, data from this proof-of-concept study demonstrated that endogenous labeling with FHC in hiPSC-CMs can be a potent strategy for enhancing the accuracy of cardiac MRI. This technology represents a significant step forward in tracking the transplanted hiPSC-CMs in the hearts of live animals.

Iron is one of the key microelements in the mammalian body and is the most abundant metal in the brain. Iron, a very important chemical element in the body of mammals, is the most abundant metal in the brain. It participates in many chemical reactions taking place in the central nervous system acting as a cofactor in key enzymatic reactions involved in neurotransmitter synthesis and degradation, dendritic arborization, and myelination. Moreover, iron accumulation in the brain has been implicated in the pathogenesis of neurogenerative disorders.

The aim of our study was to assess the influence of iron administered orally (30 mg/kg) to rats in the neonatal period (p12-p14) by testing the performance of rats in the open field and social interaction tests, and by evaluating the recognition memory, monoamine levels in some brain structures, and BDNF mRNA expression. The behavioral and biochemical tests were performed in adult p88-p92 rats.

Iron administered to rats in the neonatal period induced long-term deficits in behavioral tests in adult rats. It reduced the exploratory activity in the open field test. In the social interaction test, it induced deficits in the parameters studied, and decreased memory retention. Moreover, iron changed the brain monoamine levels in some studied brain structures and decreased the expression of BDNF mRNA in the hippocampus.

All earlier and our present results indicated that iron administered to rats in the neonatal period induced an increase in oxidative stress which resulted in a change in the brain monoamine levels and decreased BDNF mRNA expression which may play a role in iron-induced memory impairment in adult rats.

Chlorosis in azaleas is characterized by an interveinal yellowing of leaves that is typically caused by a deficiency of iron. This condition is usually due to the inability of cells to properly acquire iron as a consequence of unfavorable conditions, such as an elevated pH, rather than insufficient iron levels. The causes and effects of chlorosis were found to have similarities with those pertaining to a recently presented hypothesis that describes a pathogenic process in Alzheimer disease. This hypothesis states that iron becomes sequestered (e.g., by amyloid β and tau), causing a functional deficiency of iron that disrupts biochemical processes leading to neurodegeneration. Additional mechanisms that contribute to iron becoming unavailable include iron-containing structures not undergoing proper recycling (e.g., disrupted mitophagy and altered ferritinophagy) and failure to successfully translocate iron from one compartment to another (e.g., due to impaired lysosomal acidification). Other contributors to a functional deficiency of iron in patients with Alzheimer disease include altered metabolism of heme or altered production of iron-containing proteins and their partners (e.g., subunits, upstream proteins). A review of the evidence supporting this hypothesis is presented. Also, parallels between the mechanisms underlying a functional iron-deficient state in Alzheimer disease and those occurring for chlorosis in plants are discussed. Finally, a model describing the generation of a functional iron deficiency in Alzheimer disease is put forward.

The dyshomeostasis of metal ions in the brain leads to the accumulation of excess metals in extracellular and inter-neuronal locations and the Amyloid β peptide (Aβ) binds these transition metals, which ultimately cause the Aβ aggregation and severe oxidative stress in the brain. The aggregation of Aβ and oxidative stress are important factors to trigger Alzheimer's disease (AD). Metal chelation therapy is a promising approach to removing metals from Aβ-M species and relieve the oxidative stress. Therefore, 4 tetrahydrosalens containing benzothiazole moiety were designed and synthesized. Their biological activities for Alzheimer's disease therapy in vitro were determined by Turbidity assay, BCA protein assay, MTT assay and fluorescent probe of DCFH-DA. The results were comparing with that of non-specific chelator (cliquinol, CQ) and non-benzothiazole functionalized tetrahydrosalens, the results demonstrated that benzothiazole functionalized chelators had more efficient bio-activities in preventing Cu2+-induced Aβ aggregation, attenuating cytotoxicity mediated by Aβ-Cu2+ species and decrease the level of reactive oxygen species (ROS) in Cu2+-Aβ treated PC12 cells than that of cliquinol and non-benzothiazole functionalized analogues.

Microglial cell iron load and inflammatory activation are significant hallmarks of late-stage Alzheimer's disease (AD). In vitro, microglia preferentially upregulate the iron importer, divalent metal transporter 1 (DMT1, gene name Slc11a2) in response to inflammatory stimuli, and excess iron can augment cellular inflammation, suggesting a feed-forward loop between iron import mechanisms and inflammatory signaling. However, it is not understood whether microglial iron import mechanisms directly contribute to inflammatory signaling and chronic disease in vivo. These studies determined the effects of microglial-specific knockdown of Slc11a2 on AD-related cognitive decline and microglial transcriptional phenotype.

In vitro experiments and RT-qPCR were used to assess a role for DMT1 in amyloid-β-associated inflammation. To determine the effects of microglial Slc11a2 knockdown on AD-related phenotypes in vivo, triple-transgenic Cx3cr1Cre-ERT2;Slc11a2flfl;APP/PS1+or - mice were generated and administered corn oil or tamoxifen to induce knockdown at 5-6 months of age. Both sexes underwent behavioral analyses to assess cognition and memory (12-15 months of age). Hippocampal CD11b+ microglia were magnetically isolated from female mice (15-17 months) and bulk RNA-sequencing analysis was conducted.

DMT1 inhibition in vitro robustly decreased Aβ-induced inflammatory gene expression and cellular iron levels in conditions of excess iron. In vivo, Slc11a2KD APP/PS1 female, but not male, mice displayed a significant worsening of memory function in Morris water maze and a fear conditioning assay, along with significant hyperactivity compared to control WT and APP/PS1 mice. Hippocampal microglia from Slc11a2KD APP/PS1 females displayed significant increases in Enpp2, Ttr, and the iron-export gene, Slc40a1, compared to control APP/PS1 cells. Slc11a2KD cells from APP/PS1 females also exhibited decreased expression of markers associated with subsets of disease-associated microglia (DAMs), such as Apoe, Ctsb, Ly9, Csf1, and Hif1α.

This work suggests a sex-specific role for microglial iron import gene Slc11a2 in propagating behavioral and cognitive phenotypes in the APP/PS1 model of AD. These data also highlight an association between loss of a DAM-like phenotype in microglia and cognitive deficits in Slc11a2KD APP/PS1 female mice. Overall, this work illuminates an iron-related pathway in microglia that may serve a protective role during disease and offers insight into mechanisms behind disease-related sex differences.

The role of iron dyshomeostasis in neurodegenerative disease has implicated the involvement of genes that regulate brain iron. The homeostatic iron regulatory gene (HFE) has been at the forefront of these studies given the role of the H63D variant (H67D in mice) in increasing brain iron load. Despite iron's role in oxidative stress production, H67D mice have shown robust protection against neurotoxins and improved recovery from intracerebral hemorrhage. Previous data support the notion that H67D mice adapt to the increased brain iron concentrations and hence develop a neuroprotective environment. This adaptation is particularly evident in the lumbar spinal cord (LSC) and ventral midbrain (VM), both relevant to neurodegeneration. We studied C57BL6/129 mice with homozygous H67D compared to WT HFE. Immunohistochemistry was used to analyze dopaminergic (in the VM) and motor (in the LSC) neuron population maturation in the first 3 months. Immunoblotting was used to measure protein carbonyl content and the expression of oxidative phosphorylation complexes. Seahorse assay was used to analyze metabolism of mitochondria isolated from the LSC and VM. Finally, a Nanostring transcriptomic analysis of genes relevant to neurodegeneration within these regions was performed. Compared to WT mice, we found no difference in the viability of motor neurons in the LSC, but the dopaminergic neurons in H67D mice experienced significant decline before 3 months of age. Both regions in H67D mice had alterations in oxidative phosphorylation complex expression indicative of stress adaptation. Mitochondria from both regions of H67D mice demonstrated metabolic differences compared to WT. Transcriptional differences in these regions of H67D mice were related to cell structure and adhesion as well as cell signaling. Overall, we found that the LSC and VM undergo significant and distinct metabolic and transcriptional changes in adaptation to iron-related stress induced by the H67D HFE gene variant.

Iron is critical for neuronal activity and metabolism, and iron dysregulation alters these functions in age-related neurodegenerative disorders, such as Alzheimer's disease (AD). AD is a chronic neurodegenerative disease characterized by progressive neuronal dysfunction, memory loss and decreased cognitive function. AD patients exhibit elevated iron levels in the brain compared to age-matched non-AD individuals. However, the degree to which iron overload contributes to AD pathogenesis is unclear. Here, we evaluated the involvement of ferroptosis, an iron-dependent cell death process, in mediating AD-like pathologies in C. elegans. Results showed that iron accumulation occurred prior to the loss of neuronal function as worms age. In addition, energetic imbalance was an early event in iron-induced loss of neuronal function. Furthermore, the loss of neuronal function was, in part, due to increased mitochondrial reactive oxygen species mediated oxidative damage, ultimately resulting in ferroptotic cell death. The mitochondrial redox environment and ferroptosis were modulated by pharmacologic processes that exacerbate or abolish iron accumulation both in wild-type worms and worms with increased levels of neuronal amyloid beta (Aβ). However, neuronal Aβ worms were more sensitive to ferroptosis-mediated neuronal loss, and this increased toxicity was ameliorated by limiting the uptake of ferrous iron through knockout of divalent metal transporter 1 (DMT1). In addition, DMT1 knockout completely suppressed phenotypic measures of Aβ toxicity with age. Overall, our findings suggest that iron-induced ferroptosis alters the mitochondrial redox environment to drive oxidative damage when neuronal Aβ is overexpressed. DMT1 knockout abolishes neuronal Aβ-associated pathologies by reducing neuronal iron uptake.

Alzheimer's disease (AD) is associated with brain accumulation of amyloid-beta (Aβ) and neurofibrillary tangle formation, in addition to reduced brain docosahexaenoic acid (DHA) and increased brain iron levels. DHA requires access across the blood-brain barrier (BBB) to enter the brain, and iron has been shown to affect the expression and function of a number of BBB transporters. Therefore, this study aimed to assess the effect of iron on the expression and function of fatty acid binding protein 5 (FABP5) and fatty acid transport protein 1 (FATP1), both which mediate brain endothelial cell trafficking of DHA.

The mRNA and protein levels of FABP5 and FATP1 in human cerebral microvascular endothelial (hCMEC/D3) cells was assessed by RT-qPCR and Western blot, respectively following ferric ammonium citrate (FAC) treatment (up to 750 µM, 72 h). The function of FABP5 and FATP1 was assessed via uptake and efflux of radiolabelled 3H-oleic acid and 14C-DHA.

FAC (500 µM, 72 h) had no impact on the expression of FABP5 at the protein and mRNA level in hCMEC/D3 cells, which was associated with a lack of effect on the uptake of 14C-DHA. FAC led to a 19.7% reduction in FATP1 protein abundance in hCMEC/D3 cells with no impact on mRNA levels, and this was associated with up to a 32.6% reduction in efflux of 14C-DHA.

These studies demonstrate a role of iron in down-regulating FATP1 protein abundance and function at the BBB, which may have implications on fatty acid access to the brain.

Alzheimer's disease (AD) is the most prevalent neurodegenerative disease worldwide and has a great socio-economic impact. Modified oxidative lipid metabolism and dysregulated iron homeostasis have been implicated in the pathogenesis of this disorder, but the detailed pathophysiological mechanisms still remain unclear. Apolipoprotein E (APOE) is a lipid-binding protein that occurs in large quantities in human blood plasma, and a polymorphism of the APOE gene locus has been identified as risk factors for AD. The human genome involves three major APOE alleles (APOE2, APOE3, APOE4), which encode for three subtly distinct apolipoprotein E isoforms (APOE2, APOE3, APOE4). The canonic function of these apolipoproteins is lipid transport in blood and brain, but APOE4 allele carriers have a much higher risk for AD. In fact, about 60% of clinically diagnosed AD patients carry at least one APOE4 allele in their genomes. Although the APOE4 protein has been implicated in pathophysiological key processes of AD, such as extracellular beta-amyloid (Aβ) aggregation, mitochondrial dysfunction, neuroinflammation, formation of neurofibrillary tangles, modified oxidative lipid metabolism, and ferroptotic cell death, the underlying molecular mechanisms are still not well understood. As for all mammalian cells, iron plays a crucial role in neuronal functions and dysregulation of iron homeostasis has also been implicated in the pathogenesis of AD. Imbalances in iron homeostasis and impairment of the hydroperoxy lipid-reducing capacity induce cellular dysfunction leading to neuronal ferroptosis. In this review, we summarize the current knowledge on APOE4-related oxidative lipid metabolism and the potential role of ferroptosis in the pathogenesis of AD. Pharmacological interference with these processes might offer innovative strategies for therapeutic interventions.

Tau is a neuronal protein involved in axonal stabilization; however under pathological conditions, it triggers the deposition of insoluble neurofibrillary tangles, which are one of the biomarkers for Alzheimer's disease. The factors that might influence the fibrillation process are i) two cysteine residues in two pseudorepetitive regions, called R2 and R3, which can modulate protein-protein interaction via disulfide cross-linking; ii) an increase of reactive oxygen species affecting the post-translational modification of tau; and iii) cytotoxic levels of metals, especially ferric-heme (hemin), in hemolytic processes. Herein, we investigated how the cysteine-containing R3 peptide (R3C) and its Cys→Ala mutant (R3A) interact with hemin and how their binding affects the oxidative damage of the protein. The calculated binding constants are remarkably higher for the hemin-R3C complex (LogK1 = 5.90; LogK2 = 5.80) with respect to R3A (LogK1 = 4.44; LogK2 < 2), although NMR and CD investigations excluded the direct binding of cysteine as an iron axial ligand. Both peptides increase the peroxidase-like activity of hemin toward catecholamines and phenols, with a double catalytic efficiency detected for hemin-R3C systems. Moreover, the presence of cysteine significantly alters the susceptibility of R3 toward oxidative modifications, easily resulting in peptide dopamination and formation of cross-linked S-S derivatives.

Microglial cell iron load and inflammatory activation are significant hallmarks of late-stage Alzheimer's disease (AD). In vitro, microglia preferentially upregulate the iron importer, divalent metal transporter 1 (DMT1, gene name Slc11a2) in response to inflammatory stimuli, and excess iron can augment cellular inflammation, suggesting a feed-forward loop between iron import mechanisms and inflammatory signaling. However, it is not understood whether microglial iron import mechanisms directly contribute to inflammatory signaling and chronic disease in vivo. These studies determined the effects of microglial-specific knockdown of Slc11a2 on AD-related cognitive decline and microglial transcriptional phenotype.

In vitro experiments and RT-qPCR were used to assess a role for DMT1 in amyloid-β-associated inflammation. To determine the effects of microglial Slc11a2 knockdown on AD-related phenotypes in vivo, triple-transgenic Cx3cr1 Cre - ERT2 ;Slc11a2 flfl;APP/PS1 + or - mice were generated and administered corn oil or tamoxifen to induce knockdown at 5-6 months of age. Both sexes underwent behavioral analyses to assess cognition and memory (12-15 months of age). Hippocampal CD11b + microglia were magnetically isolated from female mice (15-17 months) and bulk RNA-sequencing analysis was conducted.

DMT1 inhibition in vitro robustly decreased Aβ-induced inflammatory gene expression and cellular iron levels in conditions of excess iron. In vivo, Slc11a2 KD APP/PS1 female, but not male, mice displayed a significant worsening of memory function in Morris water maze and a fear conditioning assay, along with significant hyperactivity compared to control WT and APP/PS1 mice. Hippocampal microglia from Slc11a2 KD APP/PS1 females displayed significant increases in Enpp2, Ttr, and the iron-export gene, Slc40a1, compared to control APP/PS1 cells. Slc11a2 KD cells from APP/PS1 females also exhibited decreased expression of markers associated with disease-associated microglia (DAMs), such as Apoe, Ctsb, Csf1, and Hif1α.

This work suggests a sex-specific role for microglial iron import gene Slc11a2 in propagating behavioral and cognitive phenotypes in the APP/PS1 model of AD. These data also highlight an association between loss of a DAM-like phenotype in microglia and cognitive deficits in Slc11a2 KD APP/PS1 female mice. Overall, this work illuminates an iron-related pathway in microglia that may serve a protective role during disease and offers insight into mechanisms behind disease-related sex differences.

Iron-mediated cell death (ferroptosis) is a proposed mechanism of Alzheimers disease (AD) pathology. While iron is essential for basic biological functions, its reactivity generates oxidants which contribute to cell damage and death. To further resolve mechanisms of iron-mediated toxicity in AD, we analyzed postmortem human brain and ApoEFAD mice. AD brains had decreased antioxidant enzymes, including those mediated by glutathione (GSH). Subcellular analyses of AD brains showed greater oxidative damage and lower antioxidant enzymes in lipid rafts, the site of amyloid processing, than in the non-raft membrane fraction. ApoE4 carriers had lower lipid raft yield with greater membrane oxidation. The hypothesized role of iron to AD pathology was tested in ApoEFAD mice by iron chelation with deferoxamine, which decreased fibrillar amyloid and lipid peroxidation, together with increased GSH-mediated antioxidants. These novel molecular pathways in iron mediated damage during AD.

Alzheimer's disease (AD), a progressive degenerative disorder first identified by Alois Alzheimer in 1907, poses a significant public health challenge. Despite its prevalence and impact, there is currently no definitive ante mortem diagnosis for AD pathogenesis. By 2050, the United States may face a staggering 13.8 million AD patients. This review provides a concise summary of current AD biomarkers, available treatments, and potential future therapeutic approaches. The review begins by outlining existing drug targets and mechanisms in AD, along with a discussion of current treatment options. We explore various approaches targeting Amyloid β (Aβ), Tau Protein aggregation, Tau Kinases, Glycogen Synthase kinase-3β, CDK-5 inhibitors, Heat Shock Proteins (HSP), oxidative stress, inflammation, metals, Apolipoprotein E (ApoE) modulators, and Notch signaling. Additionally, we examine the historical use of Estradiol (E2) as an AD therapy, as well as the outcomes of Randomized Controlled Trials (RCTs) that evaluated antioxidants (e.g., vitamin E) and omega-3 polyunsaturated fatty acids as alternative treatment options. Notably, positive effects of docosahexaenoic acid nutriment in older adults with cognitive impairment or AD are highlighted. Furthermore, this review offers insights into ongoing clinical trials and potential therapies, shedding light on the dynamic research landscape in AD treatment.

Advances in understanding the disease process in β-thalassemia supported development of various treatment strategies that resulted in improved survival. Improved survival, however, allowed multiple morbidities to manifest and cemented the need for frequent, lifelong treatment. This has directly impacted patients' health-related quality of life and opened the door for various psychiatric and cognitive disorders to potentially develop. In this review, we summarize available evidence on quality of life, depression and anxiety, suicidality, and cognitive impairment in adult patients with β-thalassemia while sharing our personal insights from experience in treating patients with both transfusion-dependent and non-transfusion-dependent forms.

Alzheimer's disease (AD) is the most common form of dementia defined by two key pathological characteristics in the brain, amyloid-β (Aβ) plaques and neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau. Microglia, the primary innate immune cells of the central nervous system (CNS), provide neuroprotection through Aβ and tau clearance but may also be neurotoxic by promoting neuroinflammation to exacerbate Aβ and tau pathogenesis in AD. Recent studies have demonstrated the importance of microglial utilization of nutrients and trace metals in controlling their activation and effector functions. Trace metals, such as zinc, have essential roles in brain health and immunity, and zinc dyshomeostasis has been implicated in AD pathogenesis. As a result of these advances, the mechanisms by which zinc homeostasis influences microglial-mediated neuroinflammation in AD is a topic of continuing interest since new strategies to treat AD are needed. Here, we review the roles of zinc in AD, including zinc activation of microglia, the associated neuroinflammatory response, and the application of these findings in new therapeutic strategies.

Elevated levels of iron occur in both cortical and subcortical regions of the CNS in patients with Alzheimer's disease. This accumulation is present early in the disease process as well as in more advanced stages. The factors potentially accounting for this increase are numerous, including: (1) Cells increase their uptake of iron and reduce their export of iron, as iron becomes sequestered (trapped within the lysosome, bound to amyloid β or tau, etc.); (2) metabolic disturbances, such as insulin resistance and mitochondrial dysfunction, disrupt cellular iron homeostasis; (3) inflammation, glutamate excitotoxicity, or other pathological disturbances (loss of neuronal interconnections, soluble amyloid β, etc.) trigger cells to acquire iron; and (4) following neurodegeneration, iron becomes trapped within microglia. Some of these mechanisms are also present in other neurological disorders and can also begin early in the disease course, indicating that iron accumulation is a relatively common event in neurological conditions. In response to pathogenic processes, the directed cellular efforts that contribute to iron buildup reflect the importance of correcting a functional iron deficiency to support essential biochemical processes. In other words, cells prioritize correcting an insufficiency of available iron while tolerating deposited iron. An analysis of the mechanisms accounting for iron accumulation in Alzheimer's disease, and in other relevant neurological conditions, is put forward.

The accumulation of amyloid plaques and increased brain redox burdens are neuropathological hallmarks of Alzheimer's disease. Altered metabolism of essential biometals is another feature of Alzheimer's, with amyloid plaques representing sites of disturbed metal homeostasis. Despite these observations, metal-targeting disease treatments have not been therapeutically effective to date. A better understanding of amyloid plaque composition and the role of the metals associated with them is critical. To establish this knowledge, the ability to resolve chemical variations at nanometer length scales relevant to biology is essential. Here, we present a methodology for the label-free, nanoscale chemical characterization of amyloid plaques within human Alzheimer's disease tissue using synchrotron X-ray spectromicroscopy. Our approach exploits a C-H carbon absorption feature, consistent with the presence of lipids, to visualize amyloid plaques selectively against the tissue background, allowing chemical analysis to be performed without the addition of amyloid dyes that alter the native sample chemistry. Using this approach, we show that amyloid plaques contain elevated levels of calcium, carbonates, and iron compared to the surrounding brain tissue. Chemical analysis of iron within plaques revealed the presence of chemically reduced, low-oxidation-state phases, including ferromagnetic metallic iron. The zero-oxidation state of ferromagnetic iron determines its high chemical reactivity and so may contribute to the redox burden in the Alzheimer's brain and thus drive neurodegeneration. Ferromagnetic metallic iron has no established physiological function in the brain and may represent a target for therapies designed to lower redox burdens in Alzheimer's disease. Additionally, ferromagnetic metallic iron has magnetic properties that are distinct from the iron oxide forms predominant in tissue, which might be exploitable for the in vivo detection of amyloid pathologies using magnetically sensitive imaging. We anticipate that this label-free X-ray imaging approach will provide further insights into the chemical composition of amyloid plaques, facilitating better understanding of how plaques influence the course of Alzheimer's disease.

The redox process and cellular senescence are involved in a range of essential physiological functions. However, they are also implicated in pathological processes underlying age-related neurodegenerative disorders, including Alzheimer's disease (AD). Elevated levels of reactive oxygen species (ROS) are generated as a result of abnormal accumulation of beta-amyloid peptide (Aβ), tau protein, and heme dyshomeostasis and is further aggravated by mitochondria dysfunction and endoplasmic reticulum (ER) stress. Excessive ROS damages vital cellular components such as proteins, DNA and lipids. Such damage eventually leads to impaired neuronal function and cell death. Heightened oxidative stress can also induce cellular senescence via activation of the senescence-associated secretory phenotype to further exacerbate inflammation and tissue dysfunction. In this review, we focus on how changes in the redox system and cellular senescence contribute to AD and how they are affected by perturbations in heme metabolism and mitochondrial function. While potential therapeutic strategies targeting such changes have received some attention, more research is necessary to bring them into clinical application.

Mitochondria are the powerhouse of the cell. Mitochondria serve as the major source of oxidative stress. Impaired mitochondria produce less adenosine triphosphate (ATP) but generate more reactive oxygen species (ROS), which could be a major factor in the oxidative imbalance observed in Alzheimer's disease (AD). Well-balanced mitochondrial respiration is important for the proper functioning of cells and human health. Indeed, recent research has shown that elevated mitochondrial respiration underlies the development and therapy resistance of many types of cancer, whereas diminished mitochondrial respiration is linked to the pathogenesis of AD. Mitochondria govern several activities that are known to be changed in lung cancer, the largest cause of cancer-related mortality worldwide. Because of the significant dependence of lung cancer cells on mitochondrial respiration, numerous studies demonstrated that blocking mitochondrial activity is a potent strategy to treat lung cancer. Heme is a central factor in mitochondrial respiration/oxidative phosphorylation (OXPHOS), and its association with cancer is the subject of increased research in recent years. In neural cells, heme is a key component in mitochondrial respiration and the production of ATP. Here, we review the role of impaired heme metabolism in the etiology of AD. We discuss the numerous mitochondrial effects that may contribute to AD and cancer. In addition to emphasizing the significance of heme in the development of both AD and cancer, this review also identifies some possible biological connections between the development of the two diseases. This review explores shared biological mechanisms (Pin1, Wnt, and p53 signaling) in cancer and AD. In cancer, these mechanisms drive cell proliferation and tumorigenic functions, while in AD, they lead to cell death. Understanding these mechanisms may help advance treatments for both conditions. This review discusses precise information regarding common risk factors, such as aging, obesity, diabetes, and tobacco usage.