|
1
|
Tang W, Rao Y, Pi L, Li J. A review on the role of MiR-193a-5p in oncogenesis and tumor progression. Front Oncol 2025; 15:1543215. [PMID: 40161373 PMCID: PMC11949885 DOI: 10.3389/fonc.2025.1543215] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/11/2024] [Accepted: 02/21/2025] [Indexed: 04/02/2025] Open
Abstract
MicroRNA (miRNA), a class of short non-coding RNA molecules comprising 18-25 nucleotides, are pivotal regulators of gene expression within physiological environments, influencing processes such as cell growth, apoptosis, proliferation, differentiation, migration (including cellular movement), and angiogenesis. They also play a crucial role in disease progression, invasion, and metastasis. Specifically, miR-193a-5p, a member of the miR-193a family, is instrumental in the development of various malignancies, including osteosarcoma, hepatocellular carcinoma, cervical cancer, melanoma, gastrointestinal cancer, lung cancer, prostate cancer, and bladder cancer. Studies have revealed that miR-193a-5p (sequence: UGGGUCUUUGCGGGCGAGAUGA; accession number: MIMAT0004614) is downregulated in numerous cancer cell lines and clinical samples. Furthermore, the tumor-suppressive effects of miR-193a-5p have been corroborated in animal models across different cancer types. These studies suggest that overexpression of this miRNA or modulation of lncRNA expression can inhibit oncogenesis. In this review, we summarize the functions of miR-193a-5p in cancer development.
Collapse
Affiliation(s)
| | | | | | - Jinping Li
- Department of Orthopaedics, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, Hunan, China
| |
Collapse
|
|
2
|
Choi JB, Sim DY, Lee HJ, Park JE, Ahn CH, Park SY, Ko HJ, Khil JH, Shim BS, Kim B, Kim SH. The microRNA-193a-5p induced ROS production and disturbed colocalization between STAT3 and androgen receptor play critical roles in cornin induced apoptosis. Phytother Res 2024; 38:1059-1070. [PMID: 38158648 DOI: 10.1002/ptr.8097] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/04/2023] [Revised: 11/20/2023] [Accepted: 11/28/2023] [Indexed: 01/03/2024]
Abstract
Though cornin is known to induce angiogenic, cardioprotective, and apoptotic effects, the apoptotic mechanism of this iridoid monoglucoside is not fully understood in prostate cancer cells to date. To elucidate the antitumor mechanism of cornin, cytotoxicity assay, cell cycle analysis, Western blotting, RT-qPCR, RNA interference, immunofluorescence, immunoprecipitation, reactive oxygen species (ROS) measurement, and inhibitor assay were applied in this work. Cornin exerted cytotoxicity, increased sub-G1 population, and cleaved PARP and caspase3 in LNCaP cells more than in DU145 cells. Consistently, cornin suppressed phosphorylation of signal transducer and activator of transcription 3 (STAT3) and disrupted the colocalization of STAT3 and androgen receptor (AR) in LNCaP and DU145 cells, along with suppression of AR, prostate-specific antigen (PSA), and 5α-reductase in LNCaP cells. Furthermore, cornin increased ROS production and the level of miR-193a-5p, while ROS inhibitor N-acetylcysteine disturbed the ability of cornin to attenuate the expression of AR, p-STAT3, PSA, pro-PARP, and pro-caspase3 in LNCaP cells. Notably, miR-193a-5p mimics the enhanced apoptotic effect of cornin, while miR-193a-5p inhibitor reverses the ability of cornin to abrogate AR, PSA, and STAT3 in LNCaP cells. Our findings suggest that ROS production and the disturbed crosstalk between STAT3 and AR by microRNA-193a-5p are critically involved in the apoptotic effect of cornin in prostate cancer cells.
Collapse
Affiliation(s)
- Jhin-Baek Choi
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Deok Yong Sim
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Hyo-Jung Lee
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Ji Eon Park
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Chi-Hoon Ahn
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Su-Yeon Park
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Hwan-Joo Ko
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Jae-Ho Khil
- Institute of Sports Science, Kyung Hee University, Yongin, Republic of Korea
| | - Bum-Sang Shim
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Bonglee Kim
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| | - Sung-Hoon Kim
- College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea
| |
Collapse
|
|
3
|
Saeidi N, Goudarzvand H, Mohammadi H, Mardi A, Ghoreishizadeh S, Shomali N, Goudarzvand M. Dysregulation of miR-193a serves as a potential contributor to MS pathogenesis via affecting RhoA and Rock1. Mult Scler Relat Disord 2023; 69:104468. [PMID: 36529069 DOI: 10.1016/j.msard.2022.104468] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/02/2022] [Revised: 11/30/2022] [Accepted: 12/12/2022] [Indexed: 12/15/2022]
Abstract
BACKGROUND Multiple sclerosis (MS) is one of the most common neurological diseases that cause chronic inflammation of the central nervous system and demyelination of the myelin sheath. At present, microRNAs (miRNAs) are considered not only a diagnostic and prognostic indicator of diseases but also a new goal in gene therapy. This study aims to find a simple, non-invasive, valuable biomarker for early detection and potential treatment of MS. METHODS In the present study, 30 patients with MS were included. The qRT-PCR method was performed to evaluate the expression level of miR-193a, RhoA, and ROCK1. Besides, western blotting was performed to determine the expression level of RhoA and ROCK1 at protein levels. Moreover, we aimed to clarify the possible correlation between miR-193a-5p and its-regulated target genes so that miR-193a-5p mimic was transfected into MS-derived cultured PBMSs, and the expression level of RhoA and ROCK1 were then evaluated by qRT-PCR and Western blotting. In the final step, the correlation between miR-193a-5p and clinicopathological features of patients was investigated. RESULTS Results showed that miR-193a was decreased while RhoA and ROCK1 were up-regulated in PBMCs obtained from patients with MS compared to the control group. It was also revealed that miR-193a transfection reduced RhoA and ROCK1 expression at mRNA and protein levels. The results from the Chi-square analysis showed that down-regulation of miR-193a was associated with increased CRP level, CSF IgG positivity, and MSSS (Multiple Sclerosis Severity Score), suggesting miR-193a is a potential diagnostic and prognostic indicator. CONCLUSION We implied that miR-193a could modulate RhoA and ROCK 1 expression in MS patients, in which its down-regulation leads to increased expression of RhoA and ROCK1 and poor prognosis of patients with MS. Therefore, miR-193a and its associated targets could serve potential prognostic, diagnostic, and therapeutic efficacy in MS patients.
Collapse
Affiliation(s)
- Nasim Saeidi
- DNA Laboratory, Analytical Laboratories, Hamilton, New Zealand
| | | | - Hamed Mohammadi
- Non-Communicable Diseases Research Center, Alborz University of Medical Sciences, Karaj, Iran
| | - Amirhossein Mardi
- Department of Immunology, School of Medicine, Alborz University of Medical Sciences, Karaj, Iran
| | - Shadi Ghoreishizadeh
- Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
| | - Navid Shomali
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Mahdi Goudarzvand
- Non-Communicable Diseases Research Center, Alborz University of Medical Sciences, Karaj, Iran; Department of Physiology and Pharmacology, Faculty of Medicine, Alborz University of Medical Sciences, Karaj, Iran.
| |
Collapse
|
|
4
|
Stuckel AJ, Khare T, Bissonnette M, Khare S. Aberrant regulation of CXCR4 in cancer via deviant microRNA-targeted interactions. Epigenetics 2022; 17:2318-2331. [PMID: 36047714 PMCID: PMC9665135 DOI: 10.1080/15592294.2022.2118947] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/25/2022] [Revised: 08/02/2022] [Accepted: 08/18/2022] [Indexed: 11/03/2022] Open
Abstract
CXCR4 is involved in many facets of cancer, including being a major player in establishing metastasis. This is in part due to the deregulation of CXCR4, which can be attributed to many genetic and epigenetic mechanisms, including aberrant microRNA-CXCR4 interaction. MicroRNAs (miRNAs) are a type of small non-coding RNA that primarily targets the 3' UTR of mRNA transcripts, which in turn suppresses mRNA and subsequent protein expression. In this review, we reported and characterized the many aberrant miRNA-CXCR4 interactions that occur throughout human cancers. In particular, we reported known target sequences located on the 3' UTR of CXCR4 transcripts that tumour suppressor miRNAs bind and therefore regulate expression by. From these aberrant interactions, we also documented affected downstream genes/pathways and whether a particular tumour suppressor miRNA was reported as a prognostic marker in its respected cancer type. In addition, a limited number of cancer-causing miRNAs coined 'oncomirs' were reported and described in relation to CXCR4 regulation. Moreover, the mechanisms underlying both tumour suppressor and oncomir deregulations concerning CXCR4 expression were also explored. Furthermore, the miR-146a-CXCR4 axis was delineated in oncoviral infected endothelial cells in the context of virus-causing cancers. Lastly, miRNA-driven therapies and CXCR4 antagonist drugs were discussed as potential future treatment options in reported cancers pertaining to deregulated miRNA-CXCR4 interactions.
Collapse
Affiliation(s)
- Alexei J. Stuckel
- Department of Medicine, Division of Gastroenterology and Hepatology, University of Missouri, Columbia, Missouri65212, USA
| | - Tripti Khare
- Department of Medicine, Division of Gastroenterology and Hepatology, University of Missouri, Columbia, Missouri65212, USA
| | - Marc Bissonnette
- Section of Gastroenterology, Hepatology and Nutrition, Department of Medicine, University of Chicago, Chicago, Il60637, USA
| | - Sharad Khare
- Department of Medicine, Division of Gastroenterology and Hepatology, University of Missouri, Columbia, Missouri65212, USA
- Harry S. Truman Memorial Veterans’ Hospital, Columbia, Missouri65201, USA
| |
Collapse
|
|
5
|
Nengroo MA, Khan MA, Verma A, Datta D. Demystifying the CXCR4 conundrum in cancer biology: Beyond the surface signaling paradigm. Biochim Biophys Acta Rev Cancer 2022; 1877:188790. [PMID: 36058380 DOI: 10.1016/j.bbcan.2022.188790] [Citation(s) in RCA: 17] [Impact Index Per Article: 5.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/17/2022] [Revised: 08/25/2022] [Accepted: 08/26/2022] [Indexed: 10/14/2022]
Abstract
The oncogenic chemokine duo CXCR4-CXCL12/SDF-1 (C-X-C Receptor 4-C-X-C Ligand 12/ Stromal-derived factor 1) has been the topic of intense scientific disquisitions since Muller et al., in her ground-breaking research, described this axis as a critical determinant of organ-specific metastasis in breast cancer. Elevated CXCR4 levels correlate with distant metastases, poor prognosis, and unfavourable outcomes in most solid tumors. Therapeutic impediment of the axis in clinics with Food and Drug Administration (FDA) approved inhibitors like AMD3100 or Plerixafor yield dubious results, contrary to pre-clinical developments. Clinical trials entailing inhibition of CXCR7 (C-X-C Receptor 7), another convicted chemokine receptor that exhibits affinity for CXCL12, reveal outcomes analogous to that of CXCR4-CXCL12 axis blockade. Of note, the cellular CXCR4 knockout phenotype varies largely from that of inhibitor treatments. These shaky findings pique great curiosity to delve further into the realm of this infamous chemokine receptor to provide a probable explanation. A multitude of recent reports suggests the presence of an increased intracellular CXCR4 pool in various cancers, both cytoplasmic and nuclear. This intracellular CXCR4 protein reserve seems active as it correlates with vital tumor attributes, viz. prognosis, aggressiveness, metastasis, and disease-free survival. Diminishing this entire intracellular CXCR4 load apart from the surface signals looks encouraging from a therapeutic point of view. Transcending beyond the classically accepted concept of ligand-mediated surface signaling, this review sheds new light on plausible associations of intracellularly compartmentalised CXCR4 with various aspects of tumorigenesis. Besides, this review also puts forward a comprehensive account of CXCR4 regulation in different cancers.
Collapse
Affiliation(s)
- Mushtaq Ahmad Nengroo
- Division of Cancer Biology, CSIR-Central Drug Research Institute (CDRI), Lucknow-226031, India
| | - Muqtada Ali Khan
- Division of Cancer Biology, CSIR-Central Drug Research Institute (CDRI), Lucknow-226031, India
| | - Ayushi Verma
- Division of Cancer Biology, CSIR-Central Drug Research Institute (CDRI), Lucknow-226031, India
| | - Dipak Datta
- Division of Cancer Biology, CSIR-Central Drug Research Institute (CDRI), Lucknow-226031, India; Academy of Scientific and Innovative Research, Ghaziabad, Uttar Pradesh 201002, India.
| |
Collapse
|
|
6
|
Ramadan F, Saab R, Hussein N, Clézardin P, Cohen PA, Ghayad SE. Non-coding RNA in rhabdomyosarcoma progression and metastasis. Front Oncol 2022; 12:971174. [PMID: 36033507 PMCID: PMC9403786 DOI: 10.3389/fonc.2022.971174] [Citation(s) in RCA: 7] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/16/2022] [Accepted: 07/25/2022] [Indexed: 12/12/2022] Open
Abstract
Rhabdomyosarcoma (RMS) is a soft tissue sarcoma of skeletal muscle differentiation, with a predominant occurrence in children and adolescents. One of the major challenges facing treatment success is the presence of metastatic disease at the time of diagnosis, commonly associated with the more aggressive fusion-positive subtype. Non-coding RNA (ncRNA) can regulate gene transcription and translation, and their dysregulation has been associated with cancer development and progression. MicroRNA (miRNA) are short non-coding nucleic acid sequences involved in the regulation of gene expression that act by targeting messenger RNA (mRNA), and their aberrant expression has been associated with both RMS initiation and progression. Other ncRNA including long non-coding RNA (lncRNA), circular RNA (circRNA) and ribosomal RNA (rRNA) have also been associated with RMS revealing important mechanistic roles in RMS biology, but these studies are still limited and require further investigation. In this review, we discuss the established roles of ncRNA in RMS differentiation, growth and progression, highlighting their potential use in RMS prognosis, as therapeutic agents or as targets of treatment.
Collapse
Affiliation(s)
- Farah Ramadan
- Department of Biology, Faculty of Science II, Lebanese University, Beirut, Lebanon
- Université Claude Bernard Lyon 1, Lyon, France
- INSERM, Unit 1033, LYOS, Lyon, France
- Department of Chemistry and Biochemistry, Laboratory of Cancer Biology and Molecular Immunology, Faculty of Science I, Lebanese University, Hadat, Lebanon
| | - Raya Saab
- Department of Anatomy, Cell Biology and Physiology, Faculty of Medicine, American University of Beirut, Beirut, Lebanon
- Department of Pediatric and Adolescent Medicine, American University of Beirut Medical Center, Beirut, Lebanon
| | - Nader Hussein
- Department of Chemistry and Biochemistry, Laboratory of Cancer Biology and Molecular Immunology, Faculty of Science I, Lebanese University, Hadat, Lebanon
| | - Philippe Clézardin
- Université Claude Bernard Lyon 1, Lyon, France
- INSERM, Unit 1033, LYOS, Lyon, France
| | - Pascale A. Cohen
- Université Claude Bernard Lyon 1, Lyon, France
- INSERM, Unit 1033, LYOS, Lyon, France
| | - Sandra E. Ghayad
- Department of Biology, Faculty of Science II, Lebanese University, Beirut, Lebanon
- Aix-Marseille University, INSERM 1263, INRAE 1260, C2VN, Marseille, France
| |
Collapse
|
|
7
|
Mostafazadeh M, Kahroba H, Haiaty S, TazeKand AP, Samadi N, Rahbarghazi R, Nouri M. In vitro exosomal transfer of Nrf2 led to the oxaliplatin resistance in human colorectal cancer LS174T cells. Cell Biochem Funct 2022; 40:391-402. [PMID: 35474580 DOI: 10.1002/cbf.3703] [Citation(s) in RCA: 14] [Impact Index Per Article: 4.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/24/2022] [Revised: 03/30/2022] [Accepted: 04/01/2022] [Indexed: 12/14/2022]
Abstract
Chemotherapy resistance is a serious pitfall in the treatment of colon cancers (CCs). Previous studies have found that exosomes (Exo) play a pivotal role in tumor drug resistance via the transfer of proteins and genetic materials to the acceptor cells. To date, the mechanisms orchestrating Exo-derived resistance in cancer cells have been the center of attention. Herein, we aimed to evaluate the role of exosomal nuclear factor erythroid 2-related factor 2 (Nrf2) on oxaliplatin (1-OHP) resistance in human colorectal cancer LS174T cells in vitro. To this end, exosomal-Nrf2-mediated 1-OHP resistance was examined using different assays. Exo was isolated from resistant LS174T cells (LS174T/R) and added to the culture medium of sensitive LS174T cells (LS174T/S). According to our data, LS174T/S cells successfully adsorbed PKH26-Exo driven from LS174T/R cells. Western blotting showed an increased Nrf2 level in Exo isolated from LS174T/R cells compared to LS174T/S cell-derived Exo (p < .05). The incubation of LS174T/S cells with LS174T/R-derived Exo increased half-maximal inhibitory concentration values in response to treatment with 1-OHP (p < .05). Besides this, the apoptotic changes were diminished in LS174T/S cells after incubation with LS174T/R-derived Exo. Of note, the exposure of LS174T/S cells to LS174T/R cell-derived Exo increased the expression of Nrf2 and P-glycoprotein (P-gp) compared to the nontreated LS174T/S cells (p < .05). In line with these changes, lower intracellular Rhodamin 123 content was detected in Exo-treated cells compared to the nontreated LS174T/S cells. Exo increased migration and clonogenic capacity of LS174T/S cells after incubation with Exo-derived from resistant cells. Of note, inhibition of Nrf2 with a specific blocker, brusatol, blunted these effects. Taken together, Exo-mediated transfer of Nrf2 is involved in the development of oxaliplatin resistance in CC cells by upregulating P-gp.
Collapse
Affiliation(s)
- Mostafa Mostafazadeh
- Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Biochemistry and Clinical Laboratories, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Houman Kahroba
- Department of Toxicogenomics, GROW School for Oncology and Developmental Biology, Maastricht University, Maastrich, The Netherlands.,Centre for Environmental Sciences, Hasselt University, Hasselt, Belgium
| | - Sanya Haiaty
- Research Center of Infectious Diseases and Tropical Medicine, Tabriz University of Medical Science, Tabriz, Iran
| | - Abbas P TazeKand
- Department of Biochemistry and Clinical Laboratories, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Nasser Samadi
- Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Biochemistry and Clinical Laboratories, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Reza Rahbarghazi
- Research Center of Infectious Diseases and Tropical Medicine, Tabriz University of Medical Science, Tabriz, Iran.,Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Applied Cell Sciences, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Mohammad Nouri
- Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Biochemistry and Clinical Laboratories, Tabriz University of Medical Sciences, Tabriz, Iran
| |
Collapse
|
|
8
|
Wang Y, Li N, Zhao J, Dai C. MiR-193a-5p serves as an inhibitor in ovarian cancer cells through RAB11A. Reprod Toxicol 2022; 110:105-112. [DOI: 10.1016/j.reprotox.2022.04.003] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/13/2021] [Revised: 04/02/2022] [Accepted: 04/07/2022] [Indexed: 11/30/2022]
|
|
9
|
Asghariazar V, Kadkhodayi M, Mansoori B, Mohammadi A, Baradaran B. Restoration of miR-143 reduces migration and proliferation of bladder cancer cells by regulating signaling pathways involved in EMT. Mol Cell Probes 2022; 61:101794. [DOI: 10.1016/j.mcp.2022.101794] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/26/2021] [Revised: 01/29/2022] [Accepted: 01/31/2022] [Indexed: 11/25/2022]
|
|
10
|
Uzuner E, Ulu GT, Gürler SB, Baran Y. The Role of MiRNA in Cancer: Pathogenesis, Diagnosis, and Treatment. Methods Mol Biol 2022; 2257:375-422. [PMID: 34432288 DOI: 10.1007/978-1-0716-1170-8_18] [Citation(s) in RCA: 37] [Impact Index Per Article: 12.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/13/2022]
Abstract
Cancer is also determined by the alterations of oncogenes and tumor suppressor genes. These gene expressions can be regulated by microRNAs (miRNA). At this point, researchers focus on addressing two main questions: "How are oncogenes and/or tumor suppressor genes regulated by miRNAs?" and "Which other mechanisms in cancer cells are regulated by miRNAs?" In this work we focus on gathering the publications answering these questions. The expression of miRNAs is affected by amplification, deletion or mutation. These processes are controlled by oncogenes and tumor suppressor genes, which regulate different mechanisms of cancer initiation and progression including cell proliferation, cell growth, apoptosis, DNA repair, invasion, angiogenesis, metastasis, drug resistance, metabolic regulation, and immune response regulation in cancer cells. In addition, profiling of miRNA is an important step in developing a new therapeutic approach for cancer.
Collapse
Affiliation(s)
- Erez Uzuner
- Molecular Biology and Genetics, Izmir Institute of Technology, Izmir, Turkey
| | - Gizem Tugçe Ulu
- Molecular Biology and Genetics, Izmir Institute of Technology, Izmir, Turkey
| | - Sevim Beyza Gürler
- Molecular Biology and Genetics, Izmir Institute of Technology, Izmir, Turkey
| | - Yusuf Baran
- Molecular Biology and Genetics, Izmir Institute of Technology, Izmir, Turkey.
| |
Collapse
|
|
11
|
Noorolyai S, Baghbani E, Shanehbandi D, Khaze Shahgoli V, Baghbanzadeh Kojabad A, Mansoori B, Hajiasgharzadeh K, Mokhtarzadeh A, Baradaran B. miR-146a-5p and miR-193a-5p Synergistically Inhibited the Proliferation of Human Colorectal Cancer Cells (HT-29 cell line) through ERK Signaling Pathway. Adv Pharm Bull 2021; 11:755-764. [PMID: 34888223 PMCID: PMC8642791 DOI: 10.34172/apb.2021.085] [Citation(s) in RCA: 8] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/27/2020] [Revised: 08/13/2020] [Accepted: 09/07/2020] [Indexed: 12/24/2022] Open
Abstract
Purpose: The expression of miR-146a-5p and miR-193a-5p in colorectal cancer (CRC) is associated with cancer development, metastasis, and reduced survival rate of the tumor-suffered subjects. This examination aimed to assess the impact of these microRNAs (miRNAs) in CRC and their mechanisms in the proliferation and migration of cancer cells. Methods: miR-146a-5p and -193a-5p were transfected into the HT-29 cell line and assessed their impact on metastasis-related genes. The synergistic effects of these miRNAs on migration were evaluated by wound healing approach. To assess the influence of these miRNAs on the proliferation of and apoptosis of cells, the MTT test, annexin V staining test, and DAPI staining test were done. Then, the protein expression of extracellular-signal-regulated kinase (ERK) and phosphorylated ERK (p-ERK) were investigated. Results: miR-146a-5p and-193a-5p could inhibit the CRC cells proliferation, and could synergistically induce apoptosis in CRC cells, and also repressed cell migration, and could reduce p-ERK expression. Conclusion: miR-146a-5p and-193a-5p have an important role in cell viability and proliferation via ERK signaling pathway. Thus, the simultaneous use of these miRNAs may be suggested as a probable therapeutic strategy in this cancer therapy.
Collapse
Affiliation(s)
- Saeed Noorolyai
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Elham Baghbani
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Dariush Shanehbandi
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | | | | | - Behzad Mansoori
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Khalil Hajiasgharzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Ahad Mokhtarzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Behzad Baradaran
- Pharmaceutical Analysis Research Center,Tabriz University of Medical Sciences, Tabriz, Iran
| |
Collapse
|
|
12
|
Yu X, Li M, Guo C, Wu Y, Zhao L, Shi Q, Song J, Song B. Therapeutic Targeting of Cancer: Epigenetic Homeostasis. Front Oncol 2021; 11:747022. [PMID: 34765551 PMCID: PMC8576334 DOI: 10.3389/fonc.2021.747022] [Citation(s) in RCA: 10] [Impact Index Per Article: 2.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/25/2021] [Accepted: 10/11/2021] [Indexed: 12/12/2022] Open
Abstract
A large number of studies have revealed that epigenetics plays an important role in cancer development. However, the currently-developed epigenetic drugs cannot achieve a stable curative effect. Thus, it may be necessary to redefine the role of epigenetics in cancer development. It has been shown that embryonic development and tumor development share significant similarities in terms of biological behavior and molecular expression patterns, and epigenetics may be the link between them. Cell differentiation is likely a manifestation of epigenetic homeostasis at the cellular level. In this article, we introduced the importance of epigenetic homeostasis in cancer development and analyzed the shortcomings of current epigenetic treatment regimens. Understanding the dynamic process of epigenetic homeostasis in organ development can help us characterize cancer according to its differentiation stages, explore new targets for cancer treatment, and improve the clinical prognosis of patients with cancer.
Collapse
Affiliation(s)
- Xiaoyuan Yu
- Department of Oncology, First Hospital of Shanxi Medical University, Taiyuan, China
| | - Menglu Li
- Shanxi Key Laboratory of Otorhinolaryngology Head and Neck Cancer, First Hospital of Shanxi Medical University, Taiyuan, China
| | - Chunyan Guo
- Department of Oncology, First Hospital of Shanxi Medical University, Taiyuan, China
| | - Yuesheng Wu
- Department of Oncology, First Hospital of Shanxi Medical University, Taiyuan, China
| | - Li Zhao
- Cancer Center, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, China
| | - Qinying Shi
- Cancer Center, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, China
| | - Jianbo Song
- Cancer Center, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, China
| | - Bin Song
- Cancer Center, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, China
| |
Collapse
|
|
13
|
Zhang Z, Yan Y, Zhang B, Ma Y, Chen C, Wang C. Long non-coding RNA SNHG17 promotes lung adenocarcinoma progression by targeting the microRNA-193a-5p/NETO2 axis. Oncol Lett 2021; 22:818. [PMID: 34671432 PMCID: PMC8503812 DOI: 10.3892/ol.2021.13079] [Citation(s) in RCA: 12] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/18/2021] [Accepted: 08/04/2021] [Indexed: 12/24/2022] Open
Abstract
Long non-coding RNAs (lncRNAs) play vital roles in human cancers. It has been reported that lncRNA SNHG17 expression is dysregulated in different types of cancer and involved in cancer progression. However, the role of SNHG17 in lung adenocarcinoma (LUAD) remains unclear. The present study aimed to investigate the role of SNHG17 in LUAD. Reverse transcription-quantitative (RT-q) PCR analysis was performed to detect SNHG17 expression in LUAD tissues and cells. The effects of SNHG17 on cancer cell migration, invasion, proliferation and epithelial-to-mesenchymal transition (EMT) were assessed via Transwell, MTT and western blot assays, respectively. The interactions between SNHG17 and microRNA (miRNA/miR)-193a-5p, miR-193a-5p and neuropilin and tolloid-like 2 (NETO2) were assessed via the dual-luciferase reporter assay. NETO2 expression and its potential role in LUAD were analyzed via RT-qPCR analysis and the UALCAN database. The results demonstrated that SNHG17 expression was significantly upregulated in LUAD tissues and cells, and high SNHG17 expression was associated with tumor-node-metastasis stage and poor prognosis of patients with LUAD. SNHG17 knockdown inhibited cell migration, invasion, proliferation and the EMT process. In addition, the results revealed that SNHG17 functions as a competing endogenous RNA of miR-193a-5p. The results of the dual-luciferase reporter assay confirmed that miR-193a-5p can directly target SNHG17. NETO2 was also predicted as a target protein of miR-193a-5p, which was confirmed via the dual-luciferase reporter assay. The roles of NETO2 knockdown in cancer cells were rescued following transfection with miR-193a-5p inhibitor or overexpression of SNHG17. Notably, high NETO2 expression was associated with poor prognosis of patients with LUAD. Bioinformatics analysis demonstrated that the promoter methylation level of NETO2 decreased in LUAD. Taken together, the results of the present study suggest that SNHG17 expression is upregulated in LUAD tissues and cells, and SNHG17 exerts tumor promoting effect by targeting the miR-193a-5p/NETO2 axis.
Collapse
Affiliation(s)
- Zhiwei Zhang
- Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin's Clinical Research Center for Cancer, Tianjin 300060, P.R. China.,Department of Thoracic Surgery, The Fifth Central Hospital of Tianjin, Tianjin 300450, P.R. China
| | - Yulan Yan
- Department of Thoracic Surgery, The Fifth Central Hospital of Tianjin, Tianjin 300450, P.R. China.,Department of Teaching and Research, The Fifth Central Hospital of Tianjin, Tianjin 300450, P.R. China
| | - Bin Zhang
- Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin's Clinical Research Center for Cancer, Tianjin 300060, P.R. China
| | - Yuchen Ma
- Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin's Clinical Research Center for Cancer, Tianjin 300060, P.R. China
| | - Chen Chen
- Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin's Clinical Research Center for Cancer, Tianjin 300060, P.R. China
| | - Changli Wang
- Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin's Clinical Research Center for Cancer, Tianjin 300060, P.R. China
| |
Collapse
|
|
14
|
Khare T, Bissonnette M, Khare S. CXCL12-CXCR4/CXCR7 Axis in Colorectal Cancer: Therapeutic Target in Preclinical and Clinical Studies. Int J Mol Sci 2021; 22:7371. [PMID: 34298991 PMCID: PMC8305488 DOI: 10.3390/ijms22147371] [Citation(s) in RCA: 69] [Impact Index Per Article: 17.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/05/2021] [Revised: 07/05/2021] [Accepted: 07/07/2021] [Indexed: 12/24/2022] Open
Abstract
Chemokines are chemotactic cytokines that promote cancer growth, metastasis, and regulate resistance to chemotherapy. Stromal cell-derived factor 1 (SDF1) also known as C-X-C motif chemokine 12 (CXCL12), a prognostic factor, is an extracellular homeostatic chemokine that is the natural ligand for chemokine receptors C-X-C chemokine receptor type 4 (CXCR4), also known as fusin or cluster of differentiation 184 (CD184) and chemokine receptor type 7 (CXCR7). CXCR4 is the most widely expressed rhodopsin-like G protein coupled chemokine receptor (GPCR). The CXCL12-CXCR4 axis is involved in tumor growth, invasion, angiogenesis, and metastasis in colorectal cancer (CRC). CXCR7, recently termed as atypical chemokine receptor 3 (ACKR3), is amongst the G protein coupled cell surface receptor family that is also commonly expressed in a large variety of cancer cells. CXCR7, like CXCR4, regulates immunity, angiogenesis, stem cell trafficking, cell growth and organ-specific metastases. CXCR4 and CXCR7 are expressed individually or together, depending on the tumor type. When expressed together, CXCR4 and CXCR7 can form homo- or hetero-dimers. Homo- and hetero-dimerization of CXCL12 and its receptors CXCR4 and CXCR7 alter their signaling activity. Only few drugs have been approved for clinical use targeting CXCL12-CXCR4/CXCR7 axis. Several CXCR4 inhibitors are in clinical trials for solid tumor treatment with limited success whereas CXCR7-specific inhibitors are still in preclinical studies for CRC. This review focuses on current knowledge of chemokine CXCL12 and its receptors CXCR4 and CXCR7, with emphasis on targeting the CXCL12-CXCR4/CXCR7 axis as a treatment strategy for CRC.
Collapse
Affiliation(s)
- Tripti Khare
- Division of Gastroenterology and Hepatology, Department of Medicine, University of Missouri, Columbia, MO 65212, USA;
| | - Marc Bissonnette
- Section of Gastroenterology, Hepatology and Nutrition, Department of Medicine, University of Chicago, Chicago, IL 60637, USA;
| | - Sharad Khare
- Division of Gastroenterology and Hepatology, Department of Medicine, University of Missouri, Columbia, MO 65212, USA;
- Harry S. Truman Memorial Veterans’ Hospital, Columbia, MO 65201, USA
| |
Collapse
|
|
15
|
Zhang S, Liu J, He J, Yi N. MicroRNA‑193a‑5p exerts a tumor suppressive role in epithelial ovarian cancer by modulating RBBP6. Mol Med Rep 2021; 24:582. [PMID: 34132380 PMCID: PMC8223108 DOI: 10.3892/mmr.2021.12221] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/03/2020] [Accepted: 06/26/2020] [Indexed: 12/16/2022] Open
Abstract
Epithelial ovarian cancer (EOC), a gynecological tumor, is associated with high mortality. MicroRNAs (miRs) serve a crucial role in EOC; however, the mechanisms underlying the effect of miRNA-193a-5p in EOC are not completely understood. Therefore, the present study aimed to investigate the expression levels of miR-193a-5p in serum samples of patients with EOC and to determine the role of miR-193a-5p in EOC. Reverse transcription-quantitative PCR was used to analyze the expression levels of miR-193a-5p in serum samples of patients with EOC and EOC cell lines. The effects of miR-193a-5p and RB binding protein 6, ubiquitin ligase (RBBP6) on the biological functions of EOC were determined by conducting a series of in vitro cell function experiments. The results indicated that the expression levels of miR-193a-5p were significantly decreased in serum samples obtained from patients with EOC and EOC cell lines compared with healthy individuals and normal cells, respectively. Further investigations indicated that RBBP6 was a target gene of miR-193a-5p. The expression levels of RBBP6 were significantly increased in patients with EOC compared with healthy individuals. In addition, in vitro analysis suggested that miR-193a-5p mimic significantly decreased SKOV3 cell proliferation, migration and invasion, and promoted SKOV3 cell apoptosis compared with the control and mimic-negative control groups. In addition, RBBP6 overexpression reversed miR-193a-5p mimic-mediated effects. In conclusion, the results of the present study suggested that downregulated expression levels of miR-193a-5p may serve an inhibitory role in EOC by inhibiting cell proliferation and metastasis, and promoting apoptosis.
Collapse
Affiliation(s)
- Shuangli Zhang
- Department of Gynecology, Beijing Ditan Hospital Capital Medical University, Beijing 100200, P.R. China
| | - Jun Liu
- Department of Gynecology, Beijing Ditan Hospital Capital Medical University, Beijing 100200, P.R. China
| | - Jie He
- Department of Gynecology, Beijing Liangxiang Hospital Capital Medical University, Beijing 100200, P.R. China
| | - Nuo Yi
- Department of Gynecology, Beijing Ditan Hospital Capital Medical University, Beijing 100200, P.R. China
| |
Collapse
|
|
16
|
Enhancement of myogenic differentiation and inhibition of rhabdomyosarcoma progression by miR-28-3p and miR-193a-5p regulated by SNAIL. MOLECULAR THERAPY. NUCLEIC ACIDS 2021; 24:888-904. [PMID: 34094709 PMCID: PMC8141673 DOI: 10.1016/j.omtn.2021.04.013] [Citation(s) in RCA: 11] [Impact Index Per Article: 2.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 09/25/2020] [Accepted: 04/13/2021] [Indexed: 12/15/2022]
Abstract
Rhabdomyosarcoma (RMS) is a soft tissue mesenchymal tumor that affects mostly children and adolescents. It originates from the impaired myogenic differentiation of stem cells or early progenitors. SNAIL, a transcription factor that regulates epithelial-to-mesenchymal transition in tumors of epithelial origin, is also a key regulator of RMS growth, progression, and myogenic differentiation. Here, we demonstrate that the SNAIL-dependent microRNAs (miRNAs) miR-28-3p and miR-193a-5p are crucial regulators of RMS growth, differentiation, and progression. miR-28-3p and miR-193a-5p diminished proliferation and arrested RMS cells in G0/G1 phase in vitro. They induced the myogenic differentiation of both RMS cells and human myoblasts by upregulating myogenic factors. Furthermore, miR-28-3p and miR-193a-5p inhibited migration in a scratch assay, adhesion to endothelial cells, chemotaxis, and invasion toward SDF-1 and HGF and regulated angiogenic capabilities of the cells. Overexpression of miR-28-3p and miR-193a-5p induced formation of fibrotic structures and abnormal blood vessels in RMS xenografts in immunodeficient mice in vivo. Simultaneous overexpression of both miRNAs diminished tumor growth after subcutaneous implantation and inhibited the engraftment of RMS cells into bone marrow after intravenous injection in vivo. To conclude, we discovered novel SNAIL-dependent miRNAs that may become new therapeutic targets in RMS in the future.
Collapse
|
|
17
|
Marofi F, Tahmasebi S, Rahman HS, Kaigorodov D, Markov A, Yumashev AV, Shomali N, Chartrand MS, Pathak Y, Mohammed RN, Jarahian M, Motavalli R, Motavalli Khiavi F. Any closer to successful therapy of multiple myeloma? CAR-T cell is a good reason for optimism. Stem Cell Res Ther 2021; 12:217. [PMID: 33781320 PMCID: PMC8008571 DOI: 10.1186/s13287-021-02283-z] [Citation(s) in RCA: 15] [Impact Index Per Article: 3.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/23/2021] [Accepted: 03/11/2021] [Indexed: 12/16/2022] Open
Abstract
Despite many recent advances on cancer novel therapies, researchers have yet a long way to cure cancer. They have to deal with tough challenges before they can reach success. Nonetheless, it seems that recently developed immunotherapy-based therapy approaches such as adoptive cell transfer (ACT) have emerged as a promising therapeutic strategy against various kinds of tumors even the cancers in the blood (liquid cancers). The hematological (liquid) cancers are hard to be targeted by usual cancer therapies, for they do not form localized solid tumors. Until recently, two types of ACTs have been developed and introduced; tumor-infiltrating lymphocytes (TILs) and chimeric antigen receptor (CAR)-T cells which the latter is the subject of our discussion. It is interesting about engineered CAR-T cells that they are genetically endowed with unique cancer-specific characteristics, so they can use the potency of the host immune system to fight against either solid or liquid cancers. Multiple myeloma (MM) or simply referred to as myeloma is a type of hematological malignancy that affects the plasma cells. The cancerous plasma cells produce immunoglobulins (antibodies) uncontrollably which consequently damage the tissues and organs and break the immune system function. Although the last few years have seen significant progressions in the treatment of MM, still a complete remission remains unconvincing. MM is a medically challenging and stubborn disease with a disappointingly low rate of survival rate. When comparing the three most occurring blood cancers (i.e., lymphoma, leukemia, and myeloma), myeloma has the lowest 5-year survival rate (around 40%). A low survival rate indicates a high mortality rate with difficulty in treatment. Therefore, novel CAR-T cell-based therapies or combination therapies along with CAT-T cells may bring new hope for multiple myeloma patients. CAR-T cell therapy has a high potential to improve the remission success rate in patients with MM. To date, many preclinical and clinical trial studies have been conducted to investigate the ability and capacity of CAR T cells in targeting the antigens on myeloma cells. Despite the problems and obstacles, CAR-T cell experiments in MM patients revealed a robust therapeutic potential. However, several factors might be considered during CAR-T cell therapy for better response and reduced side effects. Also, incorporating the CAT-T cell method into a combinational treatment schedule may be a promising approach. In this paper, with a greater emphasis on CAR-T cell application in the treatment of MM, we will discuss and introduce CAR-T cell's history and functions, their limitations, and the solutions to defeat the limitations and different types of modifications on CAR-T cells.
Collapse
Affiliation(s)
- Faroogh Marofi
- Department of Hematology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Safa Tahmasebi
- Department of Immunology, Faculty of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran
| | - Heshu Sulaiman Rahman
- Department of Physiology, College of Medicine, University of Suleimanyah, Sulaymaniyah, Iraq
| | - Denis Kaigorodov
- Director of Research Institute "MitoKey", Moscow State Medical University, Moscow, Russian Federation
| | | | - Alexei Valerievich Yumashev
- Department of Prosthetic Dentistry, Sechenov First Moscow State Medical University, Trubetskaya St., 8-2, Moscow, Russian Federation, 119991
| | - Navid Shomali
- Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | | | - Yashwant Pathak
- Faculty Affairs, Taneja College of Pharmacy, University of South Florida, Tampa, FL, USA
- Faculty of Pharmacy, Airlangga University, Surabaya, Indonesia
| | - Rebar N Mohammed
- Bone Marrow Transplant Center, Hiwa Cancer Hospital, Suleimanyah, Iraq
| | - Mostafa Jarahian
- Toxicology and Chemotherapy Unit (G401), German Cancer Research Center, 69120, Heidelberg, Germany
| | - Roza Motavalli
- Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | | |
Collapse
|
|
18
|
Ahangar NK, Hemmat N, Khalaj-Kondori M, Shadbad MA, Sabaie H, Mokhtarzadeh A, Alizadeh N, Derakhshani A, Baghbanzadeh A, Dolatkhah K, Silvestris N, Baradaran B. The Regulatory Cross-Talk between microRNAs and Novel Members of the B7 Family in Human Diseases: A Scoping Review. Int J Mol Sci 2021; 22:2652. [PMID: 33800752 PMCID: PMC7962059 DOI: 10.3390/ijms22052652] [Citation(s) in RCA: 11] [Impact Index Per Article: 2.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/22/2021] [Revised: 02/21/2021] [Accepted: 03/02/2021] [Indexed: 12/18/2022] Open
Abstract
The members of the B7 family, as immune checkpoint molecules, can substantially regulate immune responses. Since microRNAs (miRs) can regulate gene expression post-transcriptionally, we conducted a scoping review to summarize and discuss the regulatory cross-talk between miRs and new B7 family immune checkpoint molecules, i.e., B7-H3, B7-H4, B7-H5, butyrophilin like 2 (BTNL2), B7-H6, B7-H7, and immunoglobulin like domain containing receptor 2 (ILDR2). The current study was performed using a six-stage methodology structure and Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guideline. PubMed, Embase, Scopus, Cochrane, ProQuest, and Google Scholar were systematically searched to obtain the relevant records to 5 November 2020. Two authors independently reviewed the obtained records and extracted the desired data. After quantitative and qualitative analyses, we used bioinformatics approaches to extend our knowledge about the regulatory cross-talk between miRs and the abovementioned B7 family members. Twenty-seven articles were identified that fulfilled the inclusion criteria. Studies with different designs reported gene-miR regulatory axes in various cancer and non-cancer diseases. The regulatory cross-talk between the aforementioned B7 family molecules and miRs might provide valuable insights into the pathogenesis of various human diseases.
Collapse
Affiliation(s)
- Noora Karim Ahangar
- Department of Animal Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz 5166616471, Iran; (N.K.A.); (M.K.-K.)
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Nima Hemmat
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Mohammad Khalaj-Kondori
- Department of Animal Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz 5166616471, Iran; (N.K.A.); (M.K.-K.)
| | - Mahdi Abdoli Shadbad
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran;
| | - Hani Sabaie
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran;
| | - Ahad Mokhtarzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Nazila Alizadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Afshin Derakhshani
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
- IRCCS IstitutoTumori “Giovanni Paolo II” of Bari, 70124 Bari, Italy
| | - Amir Baghbanzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Katayoun Dolatkhah
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| | - Nicola Silvestris
- IRCCS IstitutoTumori “Giovanni Paolo II” of Bari, 70124 Bari, Italy
- Department of Biomedical Sciences and Human Oncology, University of Bari “Aldo Moro”, 70124 Bari, Italy
| | - Behzad Baradaran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5165665811, Iran; (N.H.); (M.A.S.); (A.M.); (N.A.); (A.D.); (A.B.); (K.D.)
| |
Collapse
|
|
19
|
Zhou Y, Cheng JT, Feng ZX, Wang YY, Zhang Y, Cai WQ, Han ZW, Wang XW, Xiang Y, Yang HY, Liu BR, Peng XC, Cui SZ, Xin HW. Could gastrointestinal tumor-initiating cells originate from cell-cell fusion in vivo? World J Gastrointest Oncol 2021; 13:92-108. [PMID: 33643526 PMCID: PMC7896421 DOI: 10.4251/wjgo.v13.i2.92] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 10/30/2020] [Revised: 12/25/2020] [Accepted: 01/28/2021] [Indexed: 02/06/2023] Open
Abstract
Tumor-initiating cells (TICs) or cancer stem cells are believed to be responsible for gastrointestinal tumor initiation, progression, metastasis, and drug resistance. It is hypothesized that gastrointestinal TICs (giTICs) might originate from cell-cell fusion. Here, we systemically evaluate the evidence that supports or opposes the hypothesis of giTIC generation from cell-cell fusion both in vitro and in vivo. We review giTICs that are capable of initiating tumors in vivo with 5000 or fewer in vivo fused cells. Under this restriction, there is currently little evidence demonstrating that giTICs originate from cell-cell fusion in vivo. However, there are many reports showing that tumor generation in vitro occurs with more than 5000 fused cells. In addition, the mechanisms of giTIC generation via cell-cell fusion are poorly understood, and thus, we propose its potential mechanisms of action. We suggest that future research should focus on giTIC origination from cell-cell fusion in vivo, isolation or enrichment of giTICs that have tumor-initiating capabilities with 5000 or less in vivo fused cells, and further clarification of the underlying mechanisms. Our review of the current advances in our understanding of giTIC origination from cell-cell fusion may have significant implications for the understanding of carcinogenesis and future cancer therapeutic strategies targeting giTICs.
Collapse
Affiliation(s)
- Yang Zhou
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Jun-Ting Cheng
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Zi-Xian Feng
- Department of Oncology and Haematology, Lianjiang People's Hospital, Guangzhou 524400, Guangdong Province, China
| | - Ying-Ying Wang
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Ying Zhang
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Wen-Qi Cai
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Zi-Wen Han
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Xian-Wang Wang
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Ying Xiang
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Hui-Yu Yang
- Department of Gastroenterology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450000, Henan Province, China
| | - Bing-Rong Liu
- Department of Gastroenterology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450000, Henan Province, China
| | - Xiao-Chun Peng
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Pathophysiology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| | - Shu-Zhong Cui
- State Key Laboratory of Respiratory Disease, Affiliated Cancer Hospital Institute of Guangzhou Medical University, Guangzhou 510095, Guangdong Province, China
| | - Hong-Wu Xin
- Laboratory of Oncology, Center for Molecular Medicine, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
- Department of Biochemistry and Molecular Biology, School of Basic Medicine, Health Science Center, Yangtze University, Jingzhou 434023, Hubei Province, China
| |
Collapse
|
|
20
|
Azar MRMH, Aghazadeh H, Mohammed HN, Sara MRS, Hosseini A, Shomali N, Tamjidifar R, Tarzi S, Mansouri M, Sarand SP, Marofi F, Akbari M, Xu H, Shotorbani SS. miR-193a-5p as a promising therapeutic candidate in colorectal cancer by reducing 5-FU and Oxaliplatin chemoresistance by targeting CXCR4. Int Immunopharmacol 2021; 92:107355. [PMID: 33429333 DOI: 10.1016/j.intimp.2020.107355] [Citation(s) in RCA: 18] [Impact Index Per Article: 4.5] [Reference Citation Analysis] [Abstract] [Key Words] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/17/2020] [Revised: 12/26/2020] [Accepted: 12/26/2020] [Indexed: 02/07/2023]
Abstract
Colorectal cancer (CRC) is one of the most common causes of cancer-related deaths worldwide. The role of microRNAs (miRNAs/miRs) as small (19-25 nucleotides in length) non-coding RNA molecules that modify gene expression has been shown in several types of cancer. 5-Fluorouracil (5-FU) and oxaliplatin (Ox) are two common chemotherapeutic agents used to treat cancer. The present study aimed to evaluate the expression levels of miR-193a-5p in CRC, and its effect on the C-X-C Motif Chemokine Receptor 4 (CXCR4) target gene alone and in combination with chemotherapeutic drugs, to determine its possible role in chemoresistance. CRC tissues and adjacent non-cancerous tissue were obtained from 67 patients who had undergone surgery to determine the expression levels of miR-193a-5p and CXCR4. Subsequently, qPCR and Western blotting were performed to determine the effect of miR-193a-5p and chemotherapy drugs on CXCR4. َAlso, MTT assay, and flow cytometry was performed to determine their role in cell viability and apoptosis. Besides, the relationship between miR-193a-5p and CXCR4 with patients' clinical features was investigated. The results of the present study showed that miR-193a-5p was significantly downregulated, whereas CXCR4 was significantly upregulated in tumor tissues obtained from patients with CRC compared with the adjacent non-tumor healthy controls. In addition, the upregulation of miR-193-5p reduced the expression levels of CXCR4, particularly in combination with 5-FU and OX. Besides, using rescue experiments, the present study showed that miR-193a-5p replacement was able to suppress CXCR4-induced CRC cell proliferation by directly targeting CXCR4. Furthermore, there was a significant association between miR-193a-5p and CXCR4 with certain clinicopathological characteristics, particularly with metastasis-related features. These results suggest that miR-193a-5p serves a tumor-suppressive function in CRC and can directly target CXCR4 and decrease its mRNA and protein expression levels. Additionally, miR-193a-5p in combination with 5-FU and Ox potentiated reducing CXR4 expression, which may reveal its contribution to tumor chemoresistance. In conclusion, miR-193-5p may be applicable as a prognostic and diagnostic marker, and also serve as a therapeutic factor by reducing CXCR4 in combination with chemotherapeutic drugs.
Collapse
Affiliation(s)
| | - Hamed Aghazadeh
- Pharmaceutical Engineering Department, Faculty of Chemical Engineering, University of Tehran, Tehran 1417414418, Iran
| | | | - Mehdi Rezai Seghin Sara
- Department of Biochemistry, Zahedan University of Medical Sciences, Zahedan 9816743463, Iran; Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran
| | - Arezoo Hosseini
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran
| | - Navid Shomali
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Student Research Committee, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran
| | - Rozita Tamjidifar
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Department of Biology Ahar Branch, Islamic Azad University, Ahar 5451116714, Iran
| | - Saeed Tarzi
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Department of Biology Ahar Branch, Islamic Azad University, Ahar 5451116714, Iran
| | - Mahmoud Mansouri
- University of Tehran, Master of Sciences in Applied Chemistry, Tehran 1417414418, Iran
| | - Sahar Pashaei Sarand
- Amirkabir University of Technology (Polytechnic of Tehran), Master of Sciences in Applied Chemistry, Tehran 441315875, Iran
| | - Faroogh Marofi
- Department of Hematology, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran
| | - Morteza Akbari
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran
| | - Huaxi Xu
- Department of Immunology, Center of Clinical Medicine and Laboratory, Jiangsu University, Zhenjiang 212013, Jiangsu Province, China.
| | - Siamak Sandoghchian Shotorbani
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; Department of Immunology, Center of Clinical Medicine and Laboratory, Jiangsu University, Zhenjiang 212013, Jiangsu Province, China.
| |
Collapse
|
|
21
|
Azarbarzin S, Hosseinpour-Feizi MA, Banan Khojasteh SM, Baradaran B, Safaralizadeh R. MicroRNA -383-5p restrains the proliferation and migration of breast cancer cells and promotes apoptosis via inhibition of PD-L1. Life Sci 2020; 267:118939. [PMID: 33359245 DOI: 10.1016/j.lfs.2020.118939] [Citation(s) in RCA: 26] [Impact Index Per Article: 5.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/25/2020] [Revised: 12/03/2020] [Accepted: 12/15/2020] [Indexed: 12/24/2022]
Abstract
AIMS MicroRNAs (miRs) play pivotal roles in breast cancer development. The dysregulation of miRs has been associated with PD-L1-mediated immune suppression. This study aimed to examine the effect of transfected miR-383-5p on breast cancer cells and T-cells and its association with clinicopathological features in affected patients. MAIN METHODS Initially, miR-383-5p and PD-L1 expression levels were investigated in breast cancer tissues. Then, MDA-MB-231 cells were transfected with miR-383-5p mimics to perform analyses. Cell viability was investigated using the MTT assay, and the annexin V/PI staining assay was performed to examine apoptosis induction. Furthermore, the effect of miR-383-5p on cell migration and cell cycle progression was analyzed using the wound-healing assay and flow cytometry, respectively. Gene and protein expressions were studied using qRT-PCR and western blotting. Finally, the effect of miR-383-5p on T-cells, which were co-cultured with cancer cells, was investigated. KEY FINDINGS Compared to non-malignant tissues, PD-L1 was up-regulated, and miR-383-5p expression was downregulated in breast cancer tissues. Moreover, miR-383-5p reduced breast cancer cell viability via inducing apoptosis and modulating the expression of apoptosis-related genes. Besides, miR-383-5p could inhibit the migration of breast cancer cells via down-regulating metastasis-related genes. Besides, transfected miR-383-5p induced the secretion of pro-inflammatory cytokines from T-cells. Furthermore, the results showed that miR-383-5p might exert its tumor-suppressive effect via inhibiting the PI3K/AKT/mTOR pathway. The inhibitory effect of transfected miR-383-5p on the PI3K/AKT/mTOR pathway might be the underlying mechanism for inhibiting tumoral PD-L1 expression. SIGNIFICANCE Overall, miR-383-5p can be a promising therapeutic agent for treating breast cancer.
Collapse
Affiliation(s)
- Shirin Azarbarzin
- Department of Animal Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz, Iran
| | | | | | - Behzad Baradaran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | - Reza Safaralizadeh
- Department of Animal Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz, Iran.
| |
Collapse
|
|
22
|
Jiang D, Xie X, Lu Z, Liu L, Qu Y, Wu S, Li Y, Li G, Wang H, Xu G. Establishment of a Colorectal Cancer-Related MicroRNA-mRNA Regulatory Network by Microarray and Bioinformatics. Front Genet 2020; 11:560186. [PMID: 33193642 PMCID: PMC7644864 DOI: 10.3389/fgene.2020.560186] [Citation(s) in RCA: 15] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/08/2020] [Accepted: 08/28/2020] [Indexed: 01/01/2023] Open
Abstract
Colorectal cancer (CRC) is one of the most malignant cancers with high morbidity and mortality. MicroRNAs (miRNAs) are small non-coding RNAs that affect biological processes by binding to mRNAs and regulating their expression, and epigenetic alterations including miRNA dysregulation are significantly involved in CRC development. Determining the effect of the miRNA-mRNA network on CRC could be helpful for developing novel therapeutic targets and prognostic biomarkers, and even improving survival. In this study, microarray assays were used to screen differentially expressed miRNAs (DE miRNAs) and mRNAs (DE mRNAs) in CRC and the adjacent normal tissues. Among the detected genes, 42 miRNAs and 142 mRNAs were significantly upregulated in CRC, while 23 miRNAs and 279 mRNAs were significantly downregulated. Through overlapping of predicted targets of DE miRNAs and anti-expressed DE mRNAs, networks of DE miRNAs and DE mRNAs in CRC were established. Additionally, the formation of a protein-protein interaction network of DE mRNAs possibly targeted by DE miRNAs, functional annotation and pathway analysis, stable subnetwork mining, and determination of hub genes provided the probable mechanism used by DE miRNAs and DE mRNAs to regulate CRC growth. Finally, validation of expression and prognostic potential of hub genes provided further support for the results above and indicated that CCL-28, GPR15, PNOC, NUSAP1, and their interacted miRNAs may be a potential signature for prognosis of CRC patients. In sum, we successfully established miRNA-mRNA regulatory networks based on microarray results targeting CRC, and these findings may elucidate the mechanisms used for CRC growth and identify miRNA-related signatures for prognosis and treatment of CRC.
Collapse
Affiliation(s)
- Dan Jiang
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China.,Institute of Clinical Laboratory Medicine, Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, School of Medical Technology, Guangdong Medical University, Dongguan, China
| | - Xiaoliang Xie
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China.,Department of Colorectal Surgery, General Hospital of Ningxia Medical University, Yinchuan, China
| | - Zhenhui Lu
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China.,Department of Hepatobiliary Surgery, General Hospital of Ningxia Medical University, Yinchuan, China
| | - Liyuan Liu
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Yuliang Qu
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Shan Wu
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Yanning Li
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Guangqi Li
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Hongxia Wang
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China
| | - Guangxian Xu
- School of Clinical Medicine, Ningxia Medical University, Yinchuan, China.,Institute of Clinical Laboratory Medicine, Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, School of Medical Technology, Guangdong Medical University, Dongguan, China
| |
Collapse
|
|
23
|
Wan S, Ni G, Ding J, Huang Y. Long Noncoding RNA FBXL19-AS1 Expedites Cell Growth, Migration and Invasion in Cervical Cancer by miR-193a-5p/PIN1 Signaling. Cancer Manag Res 2020; 12:9741-9752. [PMID: 33116834 PMCID: PMC7548239 DOI: 10.2147/cmar.s262215] [Citation(s) in RCA: 9] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/11/2020] [Accepted: 08/27/2020] [Indexed: 01/04/2023] Open
Abstract
Background Cervical cancer is one of the most prevalent malignancies in gynecology with increasing incidence in recent years. Long noncoding RNAs (lncRNAs) have been reported to regulate human cancers including cervical cancer. F-box and leucine-rich repeat protein 19 antisense RNA 1 (FBXL19-AS1) have been unmasked to exert carcinogenic functions in several cancers except cervical cancer. Aim Present study hammered at investigating the function and mechanism of FBXL19-AS1 in cervical cancer. Methods RT-qPCR was utilized to test gene expression. EdU staining, colony formation, transwell, flow cytometry and TUNEL assays were applied for measuring the impact of FBXL19-AS1 on cervical cancer cell functions. Moreover, RIP, RNA pull-down and luciferase reporter assays were utilized for detecting the correlations among FBXL19-AS1, miR-193a-5p and PIN1 (peptidylprolyl cis/trans isomerase, NIMA-interacting 1). Results FBXL19-AS1 exhibited elevated expression in cervical cancer tissues and cells. Silencing FBXL19-AS1 repressed cell proliferation through arresting cell cycle and stimulating apoptosis, and losing FBXL19-AS1 also restrained cell migration and invasion. Also, we discovered FBXL19-AS1 as a miR-193a-5p sponge, while miR-193a-5p was a tumor inhibitor in cervical cancer. Further, PIN1 was proved as the miR-193a-5p target, and FBXL19-AS1 augmented PIN1 expression in cervical cancer via sequestering miR-193a-5p. Of note, PIN1 accelerated the progression of cervical cancer, and its upregulation counteracted the impacts of depleted FBXL19-AS1 on cervical cancer cell functions. Conclusion FBXL19-AS1 contributes to malignant phenotypes in cervical cancer by sponging miR-193a-5p and regulating PIN1.
Collapse
Affiliation(s)
- Su Wan
- Department of Obstetrics and Gynecology, Yijishan Hospital of Wannan Medical College, Wuhu, Anhui 241000, People's Republic of China
| | - Guantai Ni
- Department of Obstetrics and Gynecology, Yijishan Hospital of Wannan Medical College, Wuhu, Anhui 241000, People's Republic of China
| | - Jin Ding
- Department of Obstetrics and Gynecology, Yijishan Hospital of Wannan Medical College, Wuhu, Anhui 241000, People's Republic of China
| | - Yuansheng Huang
- Department of Orthopedics, Yijishan Hospital of Wannan Medical College, Wuhu, Anhui 241000, People's Republic of China
| |
Collapse
|
|
24
|
Nabipoorashrafi SA, Shomali N, Sadat-Hatamnezhad L, Mahami-Oskouei M, Mahmoudi J, Sandoghchian Shotorbani B, Akbari M, Xu H, Sandoghchian Shotorbani S. miR-143 acts as an inhibitor of migration and proliferation as well as an inducer of apoptosis in melanoma cancer cells in vitro. IUBMB Life 2020; 72:2034-2044. [PMID: 32687246 DOI: 10.1002/iub.2345] [Citation(s) in RCA: 27] [Impact Index Per Article: 5.4] [Reference Citation Analysis] [Abstract] [Key Words] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/27/2020] [Revised: 06/11/2020] [Accepted: 06/12/2020] [Indexed: 12/20/2022]
Abstract
Melanoma is a serious form of skin cancers begins in the melanocyte. Micro-RNAs are small noncoding RNA with 19 to 25 nucleotides in length involves in the regulation of a wide range of biological processes. MicroRNAs are affected by an aberrant epigenetic alteration in the tumors that may lead to their dysregulation and formation of cancer. Recently, dysregulation of numerous microRNAs has been reported in different types of cancer. The present study focused on the role of miR-143 in carcinogenesis of melanoma cancer. Here, we evaluated the expression level of miR-143 in three melanoma cell lines in comparison with the normal human epidermal melanocyte cell line. Then, miR-143 gene plasmid transfected into the WM115 cell line, for having the lowest expression of miR-143. In addition, the effect of miR-143 transfection on mRNA and protein levels of metastasis-related genes was performed along with MTT assay, wound healing assay, and flow cytometry. The results showed that mRNA and protein expression levels of metastasis-related genes including MMP-9, E-cadherin, Vimentin, and CXCR4 have been reduced following transfection of miR-143. Moreover, the results of the scratch test showed that miR-143 re-expression inhibited cell migration. Also, the role of miR-143 in the induction of apoptosis and inhibition of proliferation by flow cytometry and MTT was confirmed. As a result, the present study showed that miR-143 was involved in metastatic and apoptotic pathways, suggesting that miR-143 acts as a tumor-suppressor microRNA in melanoma cancer.
Collapse
Affiliation(s)
| | - Navid Shomali
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran.,Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Immunology, Tabriz University of Medical Sciences, Tabriz, Iran
| | | | | | - Javad Mahmoudi
- Neurosciences Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | | | - Morteza Akbari
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Huaxi Xu
- Department of Immunology, Jiangsu University of Medical Sciences, Zhenjiang, China
| | - Siamak Sandoghchian Shotorbani
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Immunology, Tabriz University of Medical Sciences, Tabriz, Iran.,Department of Immunology, Jiangsu University of Medical Sciences, Zhenjiang, China
| |
Collapse
|
|
25
|
Wang Q, Shi L, Shi K, Yuan B, Cao G, Kong C, Fu J, Man Z, Li X, Zhang X, Feng Y, Jiang X, Zhang X, Yan J, Wu X, Sun Y. CircCSPP1 Functions as a ceRNA to Promote Colorectal Carcinoma Cell EMT and Liver Metastasis by Upregulating COL1A1. Front Oncol 2020; 10:850. [PMID: 32612946 PMCID: PMC7308451 DOI: 10.3389/fonc.2020.00850] [Citation(s) in RCA: 21] [Impact Index Per Article: 4.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/04/2020] [Accepted: 04/29/2020] [Indexed: 12/15/2022] Open
Abstract
The aberrant regulation of circular RNAs (circRNAs), ring structures formed by exon or intron backsplicing, has been identified as a novel characteristic of multiple cancers. However, the role of circRNAs in colorectal carcinoma remains to be elucidated. In the present study, we investigated the mRNA level and the promoting effect of circRNA CSPP1 (circCSPP1) in colorectal carcinoma liver metastasis. By bioinformatic analysis of 10 paired samples of colorectal carcinoma and adjacent mucosal tissues, we identified circCSPP1 as a significantly upregulated circRNA in colorectal carcinoma tissues, and its upregulation was correlated with a higher M stage. The gain- and loss-of-function assays revealed that circCSPP1 promotes the migration and invasion of colorectal carcinoma cells in vitro and in vivo. Mechanistically, similar miRNA response elements are shared between circCSPP1 and COL1A1. We demonstrated that circCSPP1 upregulates the mRNA levels of COL1A1, which plays a pivotal role in the process of epithelial–mesenchymal transition (EMT), by competitively binding to miR-193a-5p and preventing miR-193a-5p from decreasing the expression of COL1A1. In conclusion, this finding indicates that circCSPP1 may act as a promising therapeutic target by regulating the EMT process in colorectal carcinoma via activation of the circCSPP1/miR-193a-5p/COL1A1 axis.
Collapse
Affiliation(s)
- Qingyuan Wang
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China.,Department of General Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China
| | - Linsen Shi
- Department of Gastrointestinal Surgery, The Affiliated Hospital of Xuzhou Medical University, Xuzhou, China
| | - Kui Shi
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Bo Yuan
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Gang Cao
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Chenchen Kong
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Jun Fu
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Zhongsong Man
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Xu Li
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Xuanfeng Zhang
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Yifei Feng
- Department of General Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China
| | - Xinchun Jiang
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Xinhui Zhang
- Center of Hepatobiliary Pancreatic Disease, Xuzhou Central Hospital, Xuzhou, China
| | - Jun Yan
- Center of Hepatobiliary Pancreatic Disease, Beijing Tsinghua Changgung Hospital, Beijing, China
| | - Xinyong Wu
- Department of General Surgery, Xuzhou Central Hospital, Xuzhou, China
| | - Yueming Sun
- Department of General Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China
| |
Collapse
|
|
26
|
Gasparello J, Gambari L, Papi C, Rozzi A, Manicardi A, Corradini R, Gambari R, Finotti A. High Levels of Apoptosis Are Induced in the Human Colon Cancer HT-29 Cell Line by Co-Administration of Sulforaphane and a Peptide Nucleic Acid Targeting miR-15b-5p. Nucleic Acid Ther 2020; 30:164-174. [DOI: 10.1089/nat.2019.0825] [Citation(s) in RCA: 22] [Impact Index Per Article: 4.4] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/13/2022] Open
Affiliation(s)
- Jessica Gasparello
- Department of Life Sciences and Biotechnology, University of Ferrara, Ferrara, Italy
| | - Laura Gambari
- Laboratorio RAMSES, IRCCS Istituto Ortopedico Rizzoli, Bologna, Italy
| | - Chiara Papi
- Department of Life Sciences and Biotechnology, University of Ferrara, Ferrara, Italy
| | - Andrea Rozzi
- Department of Chemistry, Life Sciences and Environmental Sustainability, University of Parma, Parma, Italy
| | - Alex Manicardi
- Department of Chemistry, Life Sciences and Environmental Sustainability, University of Parma, Parma, Italy
| | - Roberto Corradini
- Department of Chemistry, Life Sciences and Environmental Sustainability, University of Parma, Parma, Italy
| | - Roberto Gambari
- Department of Life Sciences and Biotechnology, University of Ferrara, Ferrara, Italy
| | - Alessia Finotti
- Department of Life Sciences and Biotechnology, University of Ferrara, Ferrara, Italy
| |
Collapse
|
|
27
|
Ghaffari M, Asadi M, Shanehbandi D, Bornehdeli S, Sadeghzadeh M, Mohammad Reza Khani H, Ghasembaglou S. Aberrant Expression of miR-103, miR-184, miR-378, miR-497 and miR-506 in Tumor Tissue from Patients with Oral Squamous Cell Carcinoma Regulates the Clinical Picture of the Patients. Asian Pac J Cancer Prev 2020; 21:1311-1315. [PMID: 32458638 PMCID: PMC7541872 DOI: 10.31557/apjcp.2020.21.5.1311] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/23/2019] [Accepted: 03/01/2020] [Indexed: 01/17/2023] Open
Abstract
BACKGROUND This study aimed to evaluate the expression patterns of miR-103, miR-184, miR-378, miR497 and in squamous cell carcinoma (SCC) of the tongue and to be compared with normal peripheral tissues. METHODS Tumor and marginal tissues were obtained from 50 patients with OSCC. After RNA extraction, expression level of miR-103, miR-184, miR-378, miR497, and miR506 was estimated using SYBR green master mix and real-time quantitative PCR. RESULTS It was observed that, there was no detectable difference in expression level of miR-103 between tumoral and marginal tissues. However, expression level of miR-184, and miR-378 showed significant increase in tumor tissue samples compared to marginal tissue samples. MiR-497 and miR-506 demonstrated considerable decrease in tumoral cells in comparison with peripheral tissues. Moreover, the expression level of miRNAs was associated with clinicopathological features of the patients. CONCLUSIONS Our data indicated that miR-184, miR-378, miR-497, and miR-506 can be used as a potential diagnostic and prognostic biomarker in OSCC. Nevertheless, more studies are needed to confirm this claim.
.
Collapse
Affiliation(s)
- Maryam Ghaffari
- Tuberculosis and Lung Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | - Milad Asadi
- Tuberculosis and Lung Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | - Dariush Shanehbandi
- Tuberculosis and Lung Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | - Soghra Bornehdeli
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | - Mahsa Sadeghzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
| | | | - Shahram Ghasembaglou
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
- Medical Faculty, Tabriz University of Medical Science, Tabriz, Iran.
| |
Collapse
|
|
28
|
Ding Y, Li X, Zhang Y, Zhang J. Long Non-Coding RNA Cancer Susceptibility 9 (CASC9) Up-Regulates the Expression of ERBB2 by Inhibiting miR-193a-5p in Colorectal Cancer. Cancer Manag Res 2020; 12:1281-1292. [PMID: 32110102 PMCID: PMC7039100 DOI: 10.2147/cmar.s234620] [Citation(s) in RCA: 11] [Impact Index Per Article: 2.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/14/2019] [Accepted: 12/18/2019] [Indexed: 12/21/2022] Open
Abstract
Background Emerging studies have reported that long non-coding RNAs (lncRNAs) were crucial regulators in the progression of colorectal cancer (CRC). LncRNA susceptibility 9 (CASC9) was involved in several cancers; however, its role in CRC remains unknown. Methods RT-PCR was done to probe the expression of CASC9 and miR-193a-5p in CRC samples. CRC cell lines (HCT116 and SW480) were used as cell models. The biological influence of CASC9 on cancer cells was studied using CCK-8 assay, Transwell assay and TUNEL assay in vitro, and subcutaneous xenotransplanted tumor model in vivo. Interaction between CASC9 and miR-193a-5p was investigated by bioinformatics analysis, RT-PCR, and luciferase reporter assay. The expression level of the downstream gene of miR-193a-5p, erb-b2 receptor tyrosine kinase 2 (ERBB2), was tested by Western blot. Results CASC9 was significantly up-regulated in CRC samples, while miR-193a-5p was markedly down-regulated. Overexpression of CASC9 promoted viability, migration and invasion of CRC cells, while overexpression of miR-193a-5p had the opposite effect. CASC9 could down-regulate miR-193a-5p via sponging it, and there was a negative relevancy between CASC9 and miR-193a-5p in CRC samples. CASC9 also enhanced the expression levels of ERBB2, while this effect could be reversed by co-transfection with miR-193a-5p. Conclusion CASC9, an oncogenic lncRNA, was abnormally up-regulated in CRC tissues, and it could indirectly modulate the expression of ERBB2 via reducing the expression level of miR-193a-5p.
Collapse
Affiliation(s)
- Yuansheng Ding
- The First Department of General Surgery, Linyi Central Hospital, Linyi 276400, Shandong Province, People's Republic of China
| | - Xiaoyan Li
- The First Department of General Surgery, Linyi Central Hospital, Linyi 276400, Shandong Province, People's Republic of China
| | - Yucui Zhang
- The First Department of General Surgery, Linyi Central Hospital, Linyi 276400, Shandong Province, People's Republic of China
| | - Jie Zhang
- The First Department of General Surgery, Linyi Central Hospital, Linyi 276400, Shandong Province, People's Republic of China
| |
Collapse
|
|
29
|
Noorolyai S, Baghbani E, Aghebati Maleki L, Baghbanzadeh Kojabad A, Shanehbansdi D, Khaze Shahgoli V, Mokhtarzadeh A, Baradaran B. Restoration of miR-193a-5p and miR-146 a-5p Expression Induces G1 Arrest in Colorectal Cancer through Targeting of MDM2/p53. Adv Pharm Bull 2019; 10:130-134. [PMID: 32002372 PMCID: PMC6983996 DOI: 10.15171/apb.2020.017] [Citation(s) in RCA: 13] [Impact Index Per Article: 2.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/22/2019] [Revised: 08/04/2019] [Accepted: 08/13/2019] [Indexed: 12/18/2022] Open
Abstract
Purpose: Colorectal cancer (CRC) remains a universal and lethal cancer owing to metastatic and relapsing disease. Currently, the role of microRNAs has been checked in tumorigeneses. Numerous studies have revealed that between the tumor suppressor miRNAs, the reduced expression of miR-146a-5p and -193a-5p in several cancers including CRC tissues are related with tumor progression and poor prognosis of patients. The purpose of this study is to examine the role of miR-146 a-5p and -193 a-5p in CRC cell cycle progression.
Methods: The miR-193a-5p and -146 a-5p mimics were transfected into HT-29 CRC cells via jetPEI transfection reagent and their impact was assessed on p53, cyclin B, and NF-kB gene expression. The inhibitory effect of these miRNAs on cell cycle was assessed by flow cytometry. The consequence of miR-193a-5p and miR-146 a-5p on the protein expression level of Murine double minute 2 (MDM2) was assessed by western blotting.
Results: miR193a-5p and -146a-5p regulated the expression of MDM2 protein and p53, cyclin B, and NF-kB gene expression in CRC cells. Treatment of HT-29 cells with miRNA-146a-5p and -193a-5p induced G1 cell cycle arrest.
Conclusion: The findings of our study suggest that miR146a-5p and -193a-5p may act as a potential tumor suppressor by their influence on cell cycle progression in CRC cells. Thus, miRNA-146a-5p and -193a-5p restoration may be recommended as a potential therapeutic goal in the treatment of CRC patients.
Collapse
Affiliation(s)
- Saeed Noorolyai
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Elham Baghbani
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.,Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran. Introduction
| | | | | | | | | | - Ahad Mokhtarzadeh
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Behzad Baradaran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| |
Collapse
|
|
30
|
Hejazi M, Baghbani E, Amini M, Rezaei T, Aghanejad A, Mosafer J, Mokhtarzadeh A, Baradaran B. MicroRNA‐193a and taxol combination: A new strategy for treatment of colorectal cancer. J Cell Biochem 2019; 121:1388-1399. [DOI: 10.1002/jcb.29374] [Citation(s) in RCA: 28] [Impact Index Per Article: 4.7] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/11/2019] [Accepted: 08/28/2019] [Indexed: 12/24/2022]
Affiliation(s)
- Maryam Hejazi
- Department of Genetic Higher Education Institute of Rab‐Rashid Tabriz Iran
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| | - Elham Baghbani
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| | - Mohammad Amini
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| | - Tayebeh Rezaei
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| | - Ayuob Aghanejad
- Research Center for Pharmaceutical Nanotechnology Tabriz University of Medical Sciences Tabriz Iran
| | - Jafar Mosafer
- Research Center of Advanced Technologies in Medicine Torbat Heydariyeh University of Medical Sciences Torbat Heydariyeh Iran
| | - Ahad Mokhtarzadeh
- Department of Genetic Higher Education Institute of Rab‐Rashid Tabriz Iran
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| | - Behzad Baradaran
- Immunology Research Center Tabriz University of Medical Sciences Tabriz Iran
| |
Collapse
|
|
31
|
Roman-Canal B, Tarragona J, Moiola CP, Gatius S, Bonnin S, Ruiz-Miró M, Sierra JE, Rufas M, González E, Porcel JM, Gil-Moreno A, Falcón-Pérez JM, Ponomarenko J, Matias-Guiu X, Colas E. EV-associated miRNAs from peritoneal lavage as potential diagnostic biomarkers in colorectal cancer. J Transl Med 2019; 17:208. [PMID: 31221189 PMCID: PMC6585099 DOI: 10.1186/s12967-019-1954-8] [Citation(s) in RCA: 28] [Impact Index Per Article: 4.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/02/2019] [Accepted: 06/13/2019] [Indexed: 01/01/2023] Open
Abstract
BACKGROUND Colorectal cancer (CRC) is the third leading cause of cancer-related mortality worldwide. Current systematic methods for diagnosing have inherent limitations so development of a minimally-invasive diagnosis, based on the identification of sensitive biomarkers in liquid biopsies could therefore facilitate screening among population at risk. METHODS In this study, we aim to develop a novel approach to identify highly sensitive and specific biomarkers by investigating the use of extracellular vesicles (EVs) isolated from the peritoneal lavage as a source of potential miRNA diagnostic biomarkers. We isolated EVs by ultracentrifugation from 25 ascitic fluids and 25 peritoneal lavages from non-cancer and CRC patients, respectively. Analysis of the expression of EV-associated miRNAs was performed using Taqman OpenArray technology through which we could detect 371 miRNAs. RESULTS 210 miRNAs were significantly dysregulated (adjusted p value < 0.05 and abs(logFC) ≥ 1). The top-10 miRNAs, which had the AUC value higher than 0.95, were miRNA-199b-5p, miRNA-150-5p, miRNA-29c-5p, miRNA-218-5p, miRNA-99a-3p, miRNA-383-5p, miRNA-199a-3p, miRNA-193a-5p, miRNA-10b-5p and miRNA-181c-5p. CONCLUSIONS This finding opens the avenue to the use of EV-associated miRNA of peritoneal lavages as an untapped source of biomarkers for CRC.
Collapse
Affiliation(s)
- Berta Roman-Canal
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain.,Department of Pathology, University Hospital of Bellvitge, Bellvitge Biomedical Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain.,Universitat Autònoma de Barcelona (UAB), Barcelona, Spain
| | - Jordi Tarragona
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain
| | - Cristian Pablo Moiola
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain.,Biomedical Research Group in Gynecology, Vall Hebron Research Institute (VHIR), Universitat Autònoma de Barcelona, CIBERONC, Pg. Vall Hebron 119-129, 08035, Barcelona, Spain
| | - Sònia Gatius
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain
| | - Sarah Bonnin
- Centre for Genomic Regulation (CRG), The Barcelona Institute or Science and Technology, Dr. Aiguader 88, Barcelona, 08003, Spain
| | - Maria Ruiz-Miró
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain
| | - José Enrique Sierra
- Department of Surgery, Hospital Arnau de Vilanova, Biomedical Research Institute of Lleida (IRBLleida), Lleida, Spain
| | - Maria Rufas
- Department of Surgery, Hospital Arnau de Vilanova, Biomedical Research Institute of Lleida (IRBLleida), Lleida, Spain
| | - Esperanza González
- Exosomes Laboratory and Metabolomics Platform, CIC bioGUNE, CIBEREHD Bizkaia Technology Park, Derio, Spain
| | - José M Porcel
- Pleural Medicine Unit, Arnau de Vilanova University Hospital, IRBLleida, Lleida, Spain
| | - Antonio Gil-Moreno
- Biomedical Research Group in Gynecology, Vall Hebron Research Institute (VHIR), Universitat Autònoma de Barcelona, CIBERONC, Pg. Vall Hebron 119-129, 08035, Barcelona, Spain.,Gynecological Oncology Department, Vall Hebron University Hospital, CIBERONC, Barcelona, Spain
| | - Juan M Falcón-Pérez
- Exosomes Laboratory and Metabolomics Platform, CIC bioGUNE, CIBEREHD Bizkaia Technology Park, Derio, Spain.,IKERBASQUE, Basque Foundation for Science, 48011, Bilbao, Spain
| | - Julia Ponomarenko
- Centre for Genomic Regulation (CRG), The Barcelona Institute or Science and Technology, Dr. Aiguader 88, Barcelona, 08003, Spain.,University Pompeu Fabra, Barcelona, Spain
| | - Xavier Matias-Guiu
- Department of Pathology and Molecular Genetics/Oncologic Pathology Group, Biomedical Research Institute of Lleida (IRBLleida), University of Lleida, CIBERONC, Lleida, Spain. .,Department of Pathology, University Hospital of Bellvitge, Bellvitge Biomedical Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain. .,Oncologic Pathology Group, Department of Medicine UdL, Biomedical Research Institute of Lleida (IrbLleida), Av. Rovira Roure 80, 25198, Lleida, Spain.
| | - Eva Colas
- Biomedical Research Group in Gynecology, Vall Hebron Research Institute (VHIR), Universitat Autònoma de Barcelona, CIBERONC, Pg. Vall Hebron 119-129, 08035, Barcelona, Spain.
| |
Collapse
|
|
32
|
Jiang L, Meng W, Yu G, Yin C, Wang Z, Liao L, Meng F. MicroRNA-144 targets APP to regulate AML1/ETO + leukemia cell migration via the p-ERK/c-Myc/MMP-2 pathway. Oncol Lett 2019; 18:2034-2042. [PMID: 31423275 DOI: 10.3892/ol.2019.10477] [Citation(s) in RCA: 6] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/20/2018] [Accepted: 12/04/2018] [Indexed: 12/30/2022] Open
Abstract
Extramedullary infiltration (EMI) is common in patients with acute myeloid leukemia (AML) and is closely associated with the prognosis of disease. We previously reported that patients carrying the AML1/ETO (A/E) fusion gene and expressing the amyloid precursor protein (APP) tended to develop EMI, and had a poor prognosis. In the present study, the relapse-free survival (RFS) time and overall survival (OS) time were significantly lower in patients with EMI. The results demonstrated that the EMI incidence was significantly higher (P<0.05), while the RFS and OS rates were significantly lower (P<0.05), in patients with high APP expression. Kasumi-1 cells, which are A/E+, and the APP gene were used as the in vitro cell model to detect the mechanism of action in detail. Following the knockdown of APP expression, cell migration was significantly reduced (P<0.05). Furthermore, western blotting demonstrated that the protein expression of phosphorylated extracellular-signal-regulated kinase (p-ERK), matrix metalloproteinase-2 (MMP-2) and c-Myc was markedly reduced following interference of APP, while the expression of CXCR4 and MMP-9 was not altered. Kasumi-1 cells were co-cultured with p-ERK or c-Myc inhibitors and demonstrated that the APP/p-ERK/c-Myc/MMP-2 pathway was involved in signal transduction and regulation of cell migration. MicroRNA-144 (miR-144) mimics and transfected Kasumi-1 cells were generated. Reverse transcription-quantitative polymerase chain reaction and western blotting demonstrated that miR-144 was a negative regulator of APP. Taken together, the findings of the present study suggest that miR-144 negatively targets the APP gene and regulates cell migration via the APP/p-ERK/c-Myc/MMP-2 pathway.
Collapse
Affiliation(s)
- Ling Jiang
- Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510500, P.R. China
| | - Wei Meng
- Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China
| | - Guopan Yu
- Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510500, P.R. China
| | - Changxin Yin
- Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510500, P.R. China
| | - Zhixiang Wang
- Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510500, P.R. China
| | - Libin Liao
- Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510500, P.R. China
| | - Fanyi Meng
- Department of Hematology, Kang Hua Hospital, Dongguan, Guangdong 523080, P.R. China
| |
Collapse
|
|
33
|
Anvarnia A, Mohaddes‐Gharamaleki F, Asadi M, Akbari M, Yousefi B, Shanehbandi D. Dysregulated microRNAs in colorectal carcinogenesis: New insight to cell survival and apoptosis regulation. J Cell Physiol 2019; 234:21683-21693. [DOI: 10.1002/jcp.28872] [Citation(s) in RCA: 19] [Impact Index Per Article: 3.2] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/25/2019] [Revised: 04/16/2019] [Accepted: 04/17/2019] [Indexed: 12/18/2022]
Affiliation(s)
- Alireza Anvarnia
- Department of Biochemistry and Clinical Laboratories Faculty of Medicine, Tabriz University of Medical Sciences Tabriz Iran
- Student Research Committee, Tabriz University of Medical Sciences Tabriz Iran
| | - Farzad Mohaddes‐Gharamaleki
- Department of Biochemistry and Clinical Laboratories Faculty of Medicine, Tabriz University of Medical Sciences Tabriz Iran
- Student Research Committee, Tabriz University of Medical Sciences Tabriz Iran
| | - Milad Asadi
- Immunology Research Center, Tabriz University of Medical Sciences Tabriz Iran
| | - Morteza Akbari
- Immunology Research Center, Tabriz University of Medical Sciences Tabriz Iran
| | - Bahman Yousefi
- Department of Biochemistry and Clinical Laboratories Faculty of Medicine, Tabriz University of Medical Sciences Tabriz Iran
- Immunology Research Center, Tabriz University of Medical Sciences Tabriz Iran
| | - Dariush Shanehbandi
- Immunology Research Center, Tabriz University of Medical Sciences Tabriz Iran
| |
Collapse
|