|
1
|
Dominguez G, Wu Y, Zhou J. Epigenetic Regulation and Neurodevelopmental Disorders: From MeCP2 to the TCF20/PHF14 Complex. Genes (Basel) 2024; 15:1653. [PMID: 39766920 PMCID: PMC11728296 DOI: 10.3390/genes15121653] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/01/2024] [Revised: 12/17/2024] [Accepted: 12/17/2024] [Indexed: 01/12/2025] Open
Abstract
BACKGROUND Neurodevelopmental disorders (NDDs) affect approximately 15% of children and adolescents worldwide. This group of disorders is often polygenic with varying risk factors, with many associated genes converging on shared molecular pathways, including chromatin regulation and transcriptional control. Understanding how NDD-associated chromatin regulators and protein complexes orchestrate these regulatory pathways is crucial for elucidating NDD pathogenesis and developing targeted therapeutic strategies. Recently, the TCF20/PHF14 chromatin complex was identified in the mammalian brain, expanding the list of chromatin regulatory remodelers implicated in NDDs. This complex-which includes MeCP2, RAI1, TCF20, PHF14, and HMG20A-plays a vital role in epigenetic and transcriptional regulation. METHODS We review and summarize current research and clinical reports pertaining to the different components of the MeCP2-interacting TCF20/PHF14 complex. We examine the NDDs associated with the TCF20/PHF14 complex, explore the molecular and neuronal functions of its components, and discuss emerging therapeutic strategies targeting this complex to mitigate symptoms, with broader applicability to other NDDs. RESULTS Mutations in the genes encoding the components of the MeCP2-interacting TCF20/PHF14 complex have been linked to various NDDs, underscoring its critical contribution to brain development and NDD pathogenesis. CONCLUSIONS The MeCP2-interacting TCF20/PHF14 complex and its associated NDDs could serve as a model system to provide insight into the interplay between epigenetic regulation and NDD pathogenesis.
Collapse
Affiliation(s)
- Gaea Dominguez
- Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA; (G.D.); (Y.W.)
| | - Yongji Wu
- Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA; (G.D.); (Y.W.)
| | - Jian Zhou
- Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA; (G.D.); (Y.W.)
- Department of Pediatrics, Emory University School of Medicine, Atlanta, GA 30322, USA
| |
Collapse
|
|
2
|
Liu Y, Flamier A, Bell GW, Diao AJ, Whitfield TW, Wang HC, Wu Y, Schulte F, Friesen M, Guo R, Mitalipova M, Liu XS, Vos SM, Young RA, Jaenisch R. MECP2 directly interacts with RNA polymerase II to modulate transcription in human neurons. Neuron 2024; 112:1943-1958.e10. [PMID: 38697112 DOI: 10.1016/j.neuron.2024.04.007] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/17/2023] [Revised: 03/08/2024] [Accepted: 04/05/2024] [Indexed: 05/04/2024]
Abstract
Mutations in the methyl-DNA-binding protein MECP2 cause the neurodevelopmental disorder Rett syndrome (RTT). How MECP2 contributes to transcriptional regulation in normal and disease states is unresolved; it has been reported to be an activator and a repressor. We describe here the first integrated CUT&Tag, transcriptome, and proteome analyses using human neurons with wild-type (WT) and mutant MECP2 molecules. MECP2 occupies CpG-rich promoter-proximal regions in over four thousand genes in human neurons, including a plethora of autism risk genes, together with RNA polymerase II (RNA Pol II). MECP2 directly interacts with RNA Pol II, and genes occupied by both proteins showed reduced expression in neurons with MECP2 patient mutations. We conclude that MECP2 acts as a positive cofactor for RNA Pol II gene expression at many neuronal genes that harbor CpG islands in promoter-proximal regions and that RTT is due, in part, to the loss of gene activity of these genes in neurons.
Collapse
Affiliation(s)
- Yi Liu
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Anthony Flamier
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - George W Bell
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Annette Jun Diao
- Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA
| | - Troy W Whitfield
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Hao-Che Wang
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Yizhe Wu
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Fabian Schulte
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Max Friesen
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Ruisi Guo
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - Maisam Mitalipova
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
| | - X Shawn Liu
- Department of Physiology and Cellular Biophysics, Columbia University Medical Center, New York, NY 10032, USA
| | - Seychelle M Vos
- Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA; Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02142, USA
| | - Richard A Young
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA; Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA
| | - Rudolf Jaenisch
- Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA; Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA.
| |
Collapse
|
|
3
|
Mehmood A, Shah S, Guo RY, Haider A, Shi M, Ali H, Ali I, Ullah R, Li B. Methyl-CpG-Binding Protein 2 Emerges as a Central Player in Multiple Sclerosis and Neuromyelitis Optica Spectrum Disorders. Cell Mol Neurobiol 2023; 43:4071-4101. [PMID: 37955798 PMCID: PMC11407427 DOI: 10.1007/s10571-023-01432-7] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/27/2023] [Accepted: 10/27/2023] [Indexed: 11/14/2023]
Abstract
MECP2 and its product methyl-CpG binding protein 2 (MeCP2) are associated with multiple sclerosis (MS) and neuromyelitis optica spectrum disorders (NMOSD), which are inflammatory, autoimmune, and demyelinating disorders of the central nervous system (CNS). However, the mechanisms and pathways regulated by MeCP2 in immune activation in favor of MS and NMOSD are not fully understood. We summarize findings that use the binding properties of MeCP2 to identify its targets, particularly the genes recognized by MeCP2 and associated with several neurological disorders. MeCP2 regulates gene expression in neurons, immune cells and during development by modulating various mechanisms and pathways. Dysregulation of the MeCP2 signaling pathway has been associated with several disorders, including neurological and autoimmune diseases. A thorough understanding of the molecular mechanisms underlying MeCP2 function can provide new therapeutic strategies for these conditions. The nervous system is the primary system affected in MeCP2-associated disorders, and other systems may also contribute to MeCP2 action through its target genes. MeCP2 signaling pathways provide promise as potential therapeutic targets in progressive MS and NMOSD. MeCP2 not only increases susceptibility and induces anti-inflammatory responses in immune sites but also leads to a chronic increase in pro-inflammatory cytokines gene expression (IFN-γ, TNF-α, and IL-1β) and downregulates the genes involved in immune regulation (IL-10, FoxP3, and CX3CR1). MeCP2 may modulate similar mechanisms in different pathologies and suggest that treatments for MS and NMOSD disorders may be effective in treating related disorders. MeCP2 regulates gene expression in MS and NMOSD. However, dysregulation of the MeCP2 signaling pathway is implicated in these disorders. MeCP2 plays a role as a therapeutic target for MS and NMOSD and provides pathways and mechanisms that are modulated by MeCP2 in the regulation of gene expression.
Collapse
Affiliation(s)
- Arshad Mehmood
- Department of Neurology, The Second Hospital of Hebei Medical University, Shijiazhuang, 050000, Hebei, People's Republic of China
- Key Laboratory of Neurology of Hebei Province, Shijiazhuang, 050000, Hebei, People's Republic of China
| | - Suleman Shah
- Department of Cell Biology and Genetics, School of Basic Medical Sciences, Health Science Center, Shenzhen University, Shenzhen, China
| | - Ruo-Yi Guo
- Department of Neurology, The Second Hospital of Hebei Medical University, Shijiazhuang, 050000, Hebei, People's Republic of China
- Key Laboratory of Neurology of Hebei Province, Shijiazhuang, 050000, Hebei, People's Republic of China
| | - Arsalan Haider
- Key Lab of Health Psychology, Institute of Psychology, University of Chinese Academy of Sciences, Beijing, China
| | - Mengya Shi
- Department of Neurology, The Second Hospital of Hebei Medical University, Shijiazhuang, 050000, Hebei, People's Republic of China
- Key Laboratory of Neurology of Hebei Province, Shijiazhuang, 050000, Hebei, People's Republic of China
| | - Hamid Ali
- Department of Biosciences, COMSATS University Islamabad, Park Road Tarlai Kalan, Islamabad, 44000, Pakistan
| | - Ijaz Ali
- Centre for Applied Mathematics and Bioinformatics, Gulf University for Science and Technology, Hawally, 32093, Kuwait
| | - Riaz Ullah
- Medicinal Aromatic and Poisonous Plants Research Center, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia
| | - Bin Li
- Department of Neurology, The Second Hospital of Hebei Medical University, Shijiazhuang, 050000, Hebei, People's Republic of China.
- Key Laboratory of Neurology of Hebei Province, Shijiazhuang, 050000, Hebei, People's Republic of China.
| |
Collapse
|
|
4
|
Evaluation of Individuals with Non-Syndromic Global Developmental Delay and Intellectual Disability. CHILDREN 2023; 10:children10030414. [PMID: 36979972 PMCID: PMC10047567 DOI: 10.3390/children10030414] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Subscribe] [Scholar Register] [Received: 12/29/2022] [Revised: 02/11/2023] [Accepted: 02/16/2023] [Indexed: 02/24/2023]
Abstract
Global Developmental Delay (GDD) and Intellectual Disability (ID) are two of the most common presentations encountered by physicians taking care of children. GDD/ID is classified into non-syndromic GDD/ID, where GDD/ID is the sole evident clinical feature, or syndromic GDD/ID, where there are additional clinical features or co-morbidities present. Careful evaluation of children with GDD and ID, starting with detailed history followed by a thorough examination, remain the cornerstone for etiologic diagnosis. However, when initial history and examination fail to identify a probable underlying etiology, further genetic testing is warranted. In recent years, genetic testing has been shown to be the single most important diagnostic modality for clinicians evaluating children with non-syndromic GDD/ID. In this review, we discuss different genetic testing currently available, review common underlying copy-number variants and molecular pathways, explore the recent evidence and recommendations for genetic evaluation and discuss an approach to the diagnosis and management of children with non-syndromic GDD and ID.
Collapse
|
|
5
|
Meziane H, Birling MC, Wendling O, Leblanc S, Dubos A, Selloum M, Pavlovic G, Sorg T, Kalscheuer VM, Billuart P, Laumonnier F, Chelly J, van Bokhoven H, Herault Y. Large-Scale Functional Assessment of Genes Involved in Rare Diseases with Intellectual Disabilities Unravels Unique Developmental and Behaviour Profiles in Mouse Models. Biomedicines 2022; 10:biomedicines10123148. [PMID: 36551904 PMCID: PMC9775489 DOI: 10.3390/biomedicines10123148] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/23/2022] [Revised: 11/29/2022] [Accepted: 12/02/2022] [Indexed: 12/12/2022] Open
Abstract
Major progress has been made over the last decade in identifying novel genes involved in neurodevelopmental disorders, although the task of elucidating their corresponding molecular and pathophysiological mechanisms, which are an essential prerequisite for developing therapies, has fallen far behind. We selected 45 genes for intellectual disabilities to generate and characterize mouse models. Thirty-nine of them were based on the frequency of pathogenic variants in patients and literature reports, with several corresponding to de novo variants, and six other candidate genes. We used an extensive screen covering the development and adult stages, focusing specifically on behaviour and cognition to assess a wide range of functions and their pathologies, ranging from basic neurological reflexes to cognitive abilities. A heatmap of behaviour phenotypes was established, together with the results of selected mutants. Overall, three main classes of mutant lines were identified based on activity phenotypes, with which other motor or cognitive deficits were associated. These data showed the heterogeneity of phenotypes between mutation types, recapitulating several human features, and emphasizing the importance of such systematic approaches for both deciphering genetic etiological causes of ID and autism spectrum disorders, and for building appropriate therapeutic strategies.
Collapse
Affiliation(s)
- Hamid Meziane
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Marie-Christine Birling
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Olivia Wendling
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Sophie Leblanc
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Aline Dubos
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
- Université de Strasbourg, CNRS, INSERM, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Mohammed Selloum
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Guillaume Pavlovic
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Tania Sorg
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Vera M. Kalscheuer
- Max Planck Institute for Molecular Genetics, Research Group Development and Disease, Ihnestr. 63-73, 14195 Berlin, Germany
| | - Pierre Billuart
- Institute of Psychiatry and Neuroscience of Paris (IPNP), Université de Paris, INSERM U1266, “Genetic and Development of Cerebral Cortex”, 75014 Paris, France
- GHU Paris Psychiatrie et Neurosciences, Hôpital Sainte Anne, 75014 Paris, France
| | - Frédéric Laumonnier
- UMR1253, iBrain, University of Tours, Inserm, 37032 Tours, France
- Service de Génétique, Centre Hospitalier Régional Universitaire, 37044 Tours, France
| | - Jamel Chelly
- Université de Strasbourg, CNRS, INSERM, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 1 rue Laurent Fries, 67404 Illkirch, France
| | - Hans van Bokhoven
- Department of Cognitive Neuroscience, Radboudumc, 6500 HB Nijmegen, The Netherlands
- Department of Human Genetics, Radboudumc, 6500 HB Nijmegen, The Netherlands
- Donders Institute for Brain, Cognition, and Behaviour, Centre for Neuroscience, 6525 AJ Nijmegen, The Netherlands
| | - Yann Herault
- Université de Strasbourg, CNRS, INSERM, Institut Clinique de la Souris (ICS), PHENOMIN, CELPHEDIA, 1 rue Laurent Fries, 67404 Illkirch, France
- Université de Strasbourg, CNRS, INSERM, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 1 rue Laurent Fries, 67404 Illkirch, France
- Correspondence: ; Tel.: +33-388-65-5715
| |
Collapse
|
|
6
|
Yeo XY, Lim YT, Chae WR, Park C, Park H, Jung S. Alterations of presynaptic proteins in autism spectrum disorder. Front Mol Neurosci 2022; 15:1062878. [PMID: 36466804 PMCID: PMC9715400 DOI: 10.3389/fnmol.2022.1062878] [Citation(s) in RCA: 6] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/06/2022] [Accepted: 10/31/2022] [Indexed: 01/05/2025] Open
Abstract
The expanded use of hypothesis-free gene analysis methods in autism research has significantly increased the number of genetic risk factors associated with the pathogenesis of autism. A further examination of the implicated genes directly revealed the involvement in processes pertinent to neuronal differentiation, development, and function, with a predominant contribution from the regulators of synaptic function. Despite the importance of presynaptic function in synaptic transmission, the regulation of neuronal network activity, and the final behavioral output, there is a relative lack of understanding of the presynaptic contribution to the pathology of autism. Here, we will review the close association among autism-related mutations, autism spectrum disorders (ASD) phenotypes, and the altered presynaptic protein functions through a systematic examination of the presynaptic risk genes relating to the critical stages of synaptogenesis and neurotransmission.
Collapse
Affiliation(s)
- Xin Yi Yeo
- Institute of Molecular and Cell Biology, Agency for Science, Technology and Research, Singapore, Singapore
- Department of Psychological Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore
| | - Yi Tang Lim
- Institute of Molecular and Cell Biology, Agency for Science, Technology and Research, Singapore, Singapore
| | - Woo Ri Chae
- Institute of Molecular and Cell Biology, Agency for Science, Technology and Research, Singapore, Singapore
- Department of BioNano Technology, Gachon University, Seongnam, South Korea
| | - Chungwon Park
- Division of Life Science, The Hong Kong University of Science and Technology, Kowloon, Hong Kong SAR, China
| | - Hyokeun Park
- Division of Life Science, The Hong Kong University of Science and Technology, Kowloon, Hong Kong SAR, China
- Department of Physics, The Hong Kong University of Science and Technology, Kowloon, Hong Kong SAR, China
- State Key Laboratory of Molecular Neuroscience, The Hong Kong University of Science and Technology, Kowloon, Hong Kong SAR, China
| | - Sangyong Jung
- Institute of Molecular and Cell Biology, Agency for Science, Technology and Research, Singapore, Singapore
- Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore
| |
Collapse
|
|
7
|
Neklyudova A, Smirnov K, Rebreikina A, Martynova O, Sysoeva O. Electrophysiological and Behavioral Evidence for Hyper- and Hyposensitivity in Rare Genetic Syndromes Associated with Autism. Genes (Basel) 2022; 13:671. [PMID: 35456477 PMCID: PMC9027402 DOI: 10.3390/genes13040671] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/25/2022] [Revised: 03/29/2022] [Accepted: 04/05/2022] [Indexed: 01/27/2023] Open
Abstract
Our study reviewed abnormalities in spontaneous, as well as event-related, brain activity in syndromes with a known genetic underpinning that are associated with autistic symptomatology. Based on behavioral and neurophysiological evidence, we tentatively subdivided the syndromes on primarily hyper-sensitive (Fragile X, Angelman) and hypo-sensitive (Phelan-McDermid, Rett, Tuberous Sclerosis, Neurofibromatosis 1), pointing to the way of segregation of heterogeneous idiopathic ASD, that includes both hyper-sensitive and hypo-sensitive individuals. This segmentation links abnormalities in different genes, such as FMR1, UBE3A, GABRB3, GABRA5, GABRG3, SHANK3, MECP2, TSC1, TSC2, and NF1, that are causative to the above-mentioned syndromes and associated with synaptic transmission and cell growth, as well as with translational and transcriptional regulation and with sensory sensitivity. Excitation/inhibition imbalance related to GABAergic signaling, and the interplay of tonic and phasic inhibition in different brain regions might underlie this relationship. However, more research is needed. As most genetic syndromes are very rare, future investigations in this field will benefit from multi-site collaboration with a common protocol for electrophysiological and event-related potential (EEG/ERP) research that should include an investigation into all modalities and stages of sensory processing, as well as potential biomarkers of GABAergic signaling (such as 40-Hz ASSR).
Collapse
Affiliation(s)
- Anastasia Neklyudova
- Institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Science, 117485 Moscow, Russia; (A.N.); (K.S.); (A.R.); (O.M.)
| | - Kirill Smirnov
- Institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Science, 117485 Moscow, Russia; (A.N.); (K.S.); (A.R.); (O.M.)
| | - Anna Rebreikina
- Institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Science, 117485 Moscow, Russia; (A.N.); (K.S.); (A.R.); (O.M.)
- Sirius Center for Cognitive Research, Sirius University of Science and Technology, 354340 Sochi, Russia
| | - Olga Martynova
- Institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Science, 117485 Moscow, Russia; (A.N.); (K.S.); (A.R.); (O.M.)
| | - Olga Sysoeva
- Institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Science, 117485 Moscow, Russia; (A.N.); (K.S.); (A.R.); (O.M.)
- Sirius Center for Cognitive Research, Sirius University of Science and Technology, 354340 Sochi, Russia
| |
Collapse
|
|
8
|
Chen CH, Cheng MC, Huang A, Hu TM, Ping LY, Chang YS. Detection of Rare Methyl-CpG Binding Protein 2 Gene Missense Mutations in Patients With Schizophrenia. Front Genet 2020; 11:476. [PMID: 32457807 PMCID: PMC7227600 DOI: 10.3389/fgene.2020.00476] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/30/2019] [Accepted: 04/16/2020] [Indexed: 12/12/2022] Open
Abstract
Deleterious mutations of MECP2 are responsible for Rett syndrome, a severe X-linked childhood neurodevelopmental disorder predominates in females, male patients are considered fatal. However, increasing reports indicate that some MECP2 mutations may also present various neuropsychiatric phenotypes, including intellectual disability, autism spectrum disorder, depression, cocaine addiction, and schizophrenia in both males and females, suggesting varied clinical expressivity in some MECP2 mutations. Most of the MECP2 mutations are private de novo mutations. To understand whether MECP2 mutations are associated with schizophrenia, we systematically screen for mutations at the protein-coding regions of the MECP2 gene in a sample of 404 schizophrenic patients (171 females, 233 males) and 390 non-psychotic controls (171 females, 218 males). We identified six rare missense mutations in this sample, including T197M in one male patient and two female controls, L201V in nine patients (three males and six females) and 4 controls (three females and one male), L213V in one female patient, A358T in one male patient and one female control, P376S in one female patient, and P419S in one male patient. These mutations had been reported to be present in patients with various neuropsychiatric disorders other than Rett syndrome in the literature. Furthermore, we detected a novel double-missense mutation P376S-P419R in a male patient. The family study revealed that his affected sister also had this mutation. The mutation was transmitted from their mother who had a mild cognitive deficit. Our findings suggest that rare MECP2 mutations exist in some schizophrenia patients and the MECP2 gene could be considered a risk gene of schizophrenia.
Collapse
Affiliation(s)
- Chia-Hsiang Chen
- Department of Psychiatry, Chang Gung Memorial Hospital-Linkou, Taoyuan, Taiwan.,Department and Graduate Institute of Biomedical Sciences, Chang Gung University, Taoyuan, Taiwan
| | - Min-Chih Cheng
- Department of Psychiatry, Yuli Mental Health Research Center, Yuli Branch, Taipei Veterans General Hospital, Hualien, Taiwan
| | - Ailing Huang
- Department of Psychiatry, Yuli Mental Health Research Center, Yuli Branch, Taipei Veterans General Hospital, Hualien, Taiwan
| | - Tsung-Ming Hu
- Department of Psychiatry, Yuli Mental Health Research Center, Yuli Branch, Taipei Veterans General Hospital, Hualien, Taiwan
| | - Lieh-Yung Ping
- Department of Psychiatry, Yuli Mental Health Research Center, Yuli Branch, Taipei Veterans General Hospital, Hualien, Taiwan
| | - Yu-Syuan Chang
- Department of Psychiatry, Chang Gung Memorial Hospital-Linkou, Taoyuan, Taiwan
| |
Collapse
|
|
9
|
Rivell A, Mattson MP. Intergenerational Metabolic Syndrome and Neuronal Network Hyperexcitability in Autism. Trends Neurosci 2019; 42:709-726. [PMID: 31495451 PMCID: PMC6779523 DOI: 10.1016/j.tins.2019.08.006] [Citation(s) in RCA: 21] [Impact Index Per Article: 3.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/07/2019] [Revised: 07/17/2019] [Accepted: 08/06/2019] [Indexed: 12/13/2022]
Abstract
We review evidence that suggests a role for excessive consumption of energy-dense foods, particularly fructose, and consequent obesity and insulin resistance (metabolic syndrome) in the recent increase in prevalence of autism spectrum disorders (ASD). Maternal insulin resistance, obesity, and diabetes may predispose offspring to ASD by mechanisms involving chronic activation of anabolic cellular pathways and a lack of metabolic switching to ketosis resulting in a deficit in GABAergic signaling and neuronal network hyperexcitability. Metabolic reprogramming by epigenetic DNA and chromatin modifications may contribute to alterations in gene expression that result in ASD. These mechanistic insights suggest that interventions that improve metabolic health such as intermittent fasting and exercise may ameliorate developmental neuronal network abnormalities and consequent behavioral manifestations in ASD.
Collapse
Affiliation(s)
- Aileen Rivell
- Laboratory of Neurosciences, National Institute on Aging Intramural Research Program, Baltimore, MD, USA
| | - Mark P Mattson
- Laboratory of Neurosciences, National Institute on Aging Intramural Research Program, Baltimore, MD, USA; Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD, USA.
| |
Collapse
|
|
10
|
Liu Q, Chen MX, Sun L, Wallis CU, Zhou JS, Ao LJ, Li Q, Sham PC. Rational use of mesenchymal stem cells in the treatment of autism spectrum disorders. World J Stem Cells 2019; 11:55-72. [PMID: 30842805 PMCID: PMC6397804 DOI: 10.4252/wjsc.v11.i2.55] [Citation(s) in RCA: 18] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 10/09/2018] [Revised: 12/30/2018] [Accepted: 01/23/2019] [Indexed: 02/06/2023] Open
Abstract
Autism and autism spectrum disorders (ASD) refer to a range of conditions characterized by impaired social and communication skills and repetitive behaviors caused by different combinations of genetic and environmental influences. Although the pathophysiology underlying ASD is still unclear, recent evidence suggests that immune dysregulation and neuroinflammation play a role in the etiology of ASD. In particular, there is direct evidence supporting a role for maternal immune activation during prenatal life in neurodevelopmental conditions. Currently, the available options of behavioral therapies and pharmacological and supportive nutritional treatments in ASD are only symptomatic. Given the disturbing rise in the incidence of ASD, and the fact that there is no effective pharmacological therapy for ASD, there is an urgent need for new therapeutic options. Mesenchymal stem cells (MSCs) possess immunomodulatory properties that make them relevant to several diseases associated with inflammation and tissue damage. The paracrine regenerative mechanisms of MSCs are also suggested to be therapeutically beneficial for ASD. Thus the underlying pathology in ASD, including immune system dysregulation and inflammation, represent potential targets for MSC therapy. This review will focus on immune dysfunction in the pathogenesis of ASD and will further discuss the therapeutic potential for MSCs in mediating ASD-related immunological disorders.
Collapse
Affiliation(s)
- Qiang Liu
- Department of Surgery, The Chinese University of Hong Kong, Hong Kong, China
| | - Mo-Xian Chen
- School of Rehabilitation, Kunming Medical University, Kunming 650500, Yunnan Province, China
| | - Lin Sun
- Department of Psychology, Weifang Medical University, Weifang 261053, Shandong Province, China
| | - Chloe U Wallis
- Medical Sciences Division, University of Oxford, Oxford OX3 9DU, United Kingdom
| | - Jian-Song Zhou
- Mental Health Institute of the Second Xiangya Hospital, Central South University, Changsha 410011, Hunan Province, China
| | - Li-Juan Ao
- School of Rehabilitation, Kunming Medical University, Kunming 650500, Yunnan Province, China
| | - Qi Li
- Department of Psychiatry, the University of Hong Kong, Hong Kong, China
| | - Pak C Sham
- Department of Psychiatry, the University of Hong Kong, Hong Kong, China
- State Key Laboratory of Brain and Cognitive Sciences, Center for Genomic Sciences, the University of Hong Kong, Hong Kong, China
| |
Collapse
|
|
11
|
Abstract
Elucidating the functions of a particular gene is paramount to the understanding of how its dysfunction contributes to disease. This is especially important when the gene is implicated in multiple different disorders. One such gene is methyl-CpG-binding protein 2 (MECP2), which has been most prominently associated with the neurodevelopmental disorder Rett syndrome, as well as major neuropsychiatric disorders such as autism and schizophrenia. Being initially identified as a transcriptional regulator that modulates gene expression and subsequently also shown to be involved in other molecular events, dysfunction of the MeCP2 protein has the potential to affect many cellular processes. In this chapter, we will briefly review the functions of the MeCP2 protein and how its mutations are implicated in Rett syndrome and other neuropsychiatric disorders. We will further discuss about the mouse models that have been generated to specifically dissect the function of MeCP2 in different cell types and brain regions. It is envisioned that such thorough and targeted examination of MeCP2 functions can aid in enlightening the role that it plays in normal and dysfunctional physiological systems.
Collapse
Affiliation(s)
- Eunice W M Chin
- Neuroscience and Mental Health Faculty, Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore, Singapore
| | - Eyleen L K Goh
- Neuroscience and Mental Health Faculty, Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore, Singapore.
- Department of Research, National Neuroscience Institute, Singapore, Singapore.
- Neuroscience Academic Clinical Programme, Singhealth Duke-NUS Academic Medical Center, Singapore, Singapore.
| |
Collapse
|
|
12
|
KARIMZADEH P, KHEIROLLAHI M, HOUSHMAND SM, DADGAR S, ARYANI O, YAGHINI O. Clinical Feature and Genetics in Rett Syndrome: A Report on Iranian Patients. IRANIAN JOURNAL OF CHILD NEUROLOGY 2019; 13:37-51. [PMID: 31645865 PMCID: PMC6789083] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 06/20/2017] [Revised: 08/15/2018] [Accepted: 09/27/2018] [Indexed: 11/21/2022]
Abstract
OBJECTIVES Rett syndrome is characterized by normal development for the first 6-18 months of life followed by the loss of fine and gross motor skills and the ability to engage in social interaction. In most patients, mutations are found in methyl CpG-binding protein 2 (MECP2) gene. We investigated the relation between Rett clinical diagnosis and mutations in MECP2. MATERIALS & METHODS Children suspected of Rett syndrome were invited to participate in this study. Twenty-three patients from the Mofid Hospital, Tehran, Iran suffered from classic Rett syndrome diagnostic criteria were enrolled in 2012. The severity of symptoms was assessed for all of them. The peripheral blood samples were collected in EDTA tubes and the genomic DNA was extracted using standard salting out method. The mutation of MEPC2 gene was studied using DNA sequencing method. RESULTS Overall, 11(47.8%) patients had MECP2 gene mutation, while 12 cases (52.2%) had no mutations. Changes in genetics were associated with phenotypical manifestations. The most prevalent mutation was p.v288 mainly associated with partially or uncontrolled seizures. CONCLUSION For the first time, we studies the Rett syndrome in terms of clinical manifestations and genetic changes in Iran.
Collapse
Affiliation(s)
- Parvaneh KARIMZADEH
- Pediatric Neurology ResearchCenter, Research Institute forChildren’s Health, Shahid Beheshti University of MedicalSciences, Tehran, Iran,Pediatric NeurologyDepartment, Mofid Children’s Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
| | - Majid KHEIROLLAHI
- Department of Medical Genetics, Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of Non-communicable Disease, Isfahan, Iran.
| | - Seyed Massoud HOUSHMAND
- Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
| | - Sepideh DADGAR
- Department of Medical Genetic Medical Center and Faculty, Member of NIGEB, Tehran, Iran
| | - Omid ARYANI
- Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
| | - Omid YAGHINI
- Pediatric Neurology, Child growth and Development research center, Research Institute for Primordial Prevention of Noncommunicable Disease of Medical Genetic, Isfahan University of Medical Sciences. Isfahan, Iran.
| |
Collapse
|
|
13
|
Jeon SJ, Gonzales EL, Mabunga DFN, Valencia ST, Kim DG, Kim Y, Adil KJL, Shin D, Park D, Shin CY. Sex-specific Behavioral Features of Rodent Models of Autism Spectrum Disorder. Exp Neurobiol 2018; 27:321-343. [PMID: 30429643 PMCID: PMC6221834 DOI: 10.5607/en.2018.27.5.321] [Citation(s) in RCA: 31] [Impact Index Per Article: 4.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/02/2018] [Revised: 10/08/2018] [Accepted: 10/10/2018] [Indexed: 12/13/2022] Open
Abstract
Sex is an important factor in understanding the clinical presentation, management, and developmental trajectory of children with neuropsychiatric disorders. While much is known about the clinical and neurobehavioral profiles of males with neuropsychiatric disorders, surprisingly little is known about females in this respect. Animal models may provide detailed mechanistic information about sex differences in autism spectrum disorder (ASD) in terms of manifestation, disease progression, and development of therapeutic options. This review aims to widen our understanding of the role of sex in autism spectrum disorder, by summarizing and comparing behavioral characteristics of animal models. Our current understanding of how differences emerge in boys and girls with neuropsychiatric disorders is limited: Information derived from animal studies will stimulate future research on the role of biological maturation rates, sex hormones, sex-selective protective (or aggravating) factors and psychosocial factors, which are essential to devise sex precision medicine and to improve diagnostic accuracy. Moreover, there is a strong need of novel strategies to elucidate the major mechanisms leading to sex-specific autism features, as well as novel models or methods to examine these sex differences.
Collapse
Affiliation(s)
- Se Jin Jeon
- Center for Neuroscience, Korea Institute of Science & Technology, Seoul 02792, Korea.,Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea
| | - Edson Luck Gonzales
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Darine Froy N Mabunga
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Schley T Valencia
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Do Gyeong Kim
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Yujeong Kim
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Keremkleroo Jym L Adil
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Dongpil Shin
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Donghyun Park
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea
| | - Chan Young Shin
- Department of Pharmacology and Advanced Translational Medicine, School of Medicine, Konkuk University, Seoul 05029, Korea.,Department of Neuroscience, School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, Korea.,KU Open Innovation Center, Konkuk University, Seoul 05029, Korea
| |
Collapse
|
|
14
|
Le Thi Thanh H, Do Thi Diem T, Duy CV, Thanh HLT, Phuong HBT, Thanh LN. Spectrum of MECP2 mutations in Vietnamese patients with RETT syndrome. BMC MEDICAL GENETICS 2018; 19:137. [PMID: 30081849 PMCID: PMC6090653 DOI: 10.1186/s12881-018-0658-x] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 03/20/2018] [Accepted: 07/30/2018] [Indexed: 11/29/2022]
Abstract
Background Rett syndrome (RTT) is a severe neurodevelopmental disorder in children characterized by a normal neurodevelopmental process in the first 6–18 months followed by a period of motor and vocal deterioration with stereotypic hand movements. Incidence of RTT is mostly due to de novo mutation in the MECP2 gene (methyl-CpG-binding protein 2). Methods The study assessed 27 female patients presented with classical RTT phenotype age range from 18 months to 48 months. Specialist carried out the clinical evaluation and diagnosis according to RTT diagnosis criteria. Blood samples from patients were then collected for genomic DNA extraction. We next performed MECP2 gene amplification and sequencing of the whole coding region to screen for mutations. Result MECP2 mutation was found in 20 patients (74%) including: 2 missense, 4 nonsense, 6 frameshift and 2 deletion mutation. The study identified 14 pathogenic mutations which we found 4 mutation, to our knowledge and extensive search, not priory reported in any mutation database or publication: c.1384-1385DelGT, c.1205insT, c.717delC and c.1132_1207del77. High percentage of C > T (70%) in CpG sites mutation was found. Conclusion Our result reveals a high percentage of C > T mutation in CpG hot spot, which is more prone to modification and more likely to be detected in RTT as a disorder is strictly due to de novo mutations. The study is the first to identify the mutation spectrum of MECP2 gene in Vietnamese patients and also an important step toward better diagnosis and care for RTT patients in Vietnam.
Collapse
Affiliation(s)
- Huong Le Thi Thanh
- Department of Gene Technology - Vinmec Research Institute of Stem cell and Gene Technology, 458 Minh Khai Street, Hanoi, Hai Ba Trung district, Vietnam.
| | - Trinh Do Thi Diem
- Department of Gene Technology - Vinmec Research Institute of Stem cell and Gene Technology, 458 Minh Khai Street, Hanoi, Hai Ba Trung district, Vietnam
| | - Chinh Vu Duy
- Vinmec International Hospital, 458 Minh Khai Street, Hai Ba Trung District, Hanoi, Vietnam
| | - Ha Ly Thi Thanh
- Department of Gene Technology - Vinmec Research Institute of Stem cell and Gene Technology, 458 Minh Khai Street, Hanoi, Hai Ba Trung district, Vietnam
| | - Hoa Bui Thi Phuong
- Department of Gene Technology - Vinmec Research Institute of Stem cell and Gene Technology, 458 Minh Khai Street, Hanoi, Hai Ba Trung district, Vietnam
| | - Liem Nguyen Thanh
- Department of Gene Technology - Vinmec Research Institute of Stem cell and Gene Technology, 458 Minh Khai Street, Hanoi, Hai Ba Trung district, Vietnam
| |
Collapse
|
|
15
|
Muthusamy B, Selvan LDN, Nguyen TT, Manoj J, Stawiski EW, Jaiswal BS, Wang W, Raja R, Ramprasad VL, Gupta R, Murugan S, Kadandale JS, Prasad TSK, Reddy K, Peterson A, Pandey A, Seshagiri S, Girimaji SC, Gowda H. Next-Generation Sequencing Reveals Novel Mutations in X-linked Intellectual Disability. OMICS-A JOURNAL OF INTEGRATIVE BIOLOGY 2018; 21:295-303. [PMID: 28481730 DOI: 10.1089/omi.2017.0009] [Citation(s) in RCA: 26] [Impact Index Per Article: 3.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/30/2022]
Abstract
Robust diagnostics for many human genetic disorders are much needed in the pursuit of global personalized medicine. Next-generation sequencing now offers new promise for biomarker and diagnostic discovery, in developed as well as resource-limited countries. In this broader global health context, X-linked intellectual disability (XLID) is an inherited genetic disorder that is associated with a range of phenotypes impacting societies in both developed and developing countries. Although intellectual disability arises due to diverse causes, a substantial proportion is caused by genomic alterations. Studies have identified causal XLID genomic alterations in more than 100 protein-coding genes located on the X-chromosome. However, the causes for a substantial number of intellectual disability and associated phenotypes still remain unknown. Identification of causative genes and novel mutations will help in early diagnosis as well as genetic counseling of families. Advent of next-generation sequencing methods has accelerated the discovery of new genes involved in mental health disorders. In this study, we analyzed the exomes of three families from India with nonsyndromic XLID comprising seven affected individuals. The affected individuals had varying degrees of intellectual disability, microcephaly, and delayed motor and language milestones. We identified potential causal variants in three XLID genes, including PAK3 (V294M), CASK (complex structural variant), and MECP2 (P354T). Our findings reported in this study extend the spectrum of mutations and phenotypes associated with XLID, and calls for further studies of intellectual disability and mental health disorders with use of next-generation sequencing technologies.
Collapse
Affiliation(s)
- Babylakshmi Muthusamy
- 1 Institute of Bioinformatics , International Technology Park, Bangalore, India .,2 Centre for Bioinformatics, Pondicherry University , Puducherry, India
| | | | - Thong T Nguyen
- 3 Molecular Biology Department, Genentech, Inc. , South San Francisco, California
| | - Jesna Manoj
- 4 Department of Child and Adolescent Psychiatry, NIMHANS , Bangalore, India
| | - Eric W Stawiski
- 3 Molecular Biology Department, Genentech, Inc. , South San Francisco, California.,5 Department of Bioinformatics and Computational Biology, Genentech, Inc. , South San Francisco, California
| | - Bijay S Jaiswal
- 3 Molecular Biology Department, Genentech, Inc. , South San Francisco, California
| | - Weiru Wang
- 6 Department of Structural Biology, Genentech, Inc. , South San Francisco, California
| | - Remya Raja
- 1 Institute of Bioinformatics , International Technology Park, Bangalore, India
| | | | | | | | | | - T S Keshava Prasad
- 1 Institute of Bioinformatics , International Technology Park, Bangalore, India .,9 YU-IOB Center for Systems Biology and Molecular Medicine, Yenepoya University , Mangalore, India .,10 NIMHANS-IOB Proteomics and Bioinformatics Laboratory, Neurobiology Research Centre, National Institute of Mental Health and Neurosciences , Bangalore, India
| | - Kavita Reddy
- 1 Institute of Bioinformatics , International Technology Park, Bangalore, India
| | - Andrew Peterson
- 3 Molecular Biology Department, Genentech, Inc. , South San Francisco, California
| | - Akhilesh Pandey
- 11 McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine , Baltimore, Maryland.,12 Department of Biological Chemistry, Johns Hopkins University School of Medicine , Baltimore, Maryland.,13 Department of Pathology, Johns Hopkins University School of Medicine , Baltimore, Maryland
| | - Somasekar Seshagiri
- 3 Molecular Biology Department, Genentech, Inc. , South San Francisco, California
| | | | - Harsha Gowda
- 1 Institute of Bioinformatics , International Technology Park, Bangalore, India .,9 YU-IOB Center for Systems Biology and Molecular Medicine, Yenepoya University , Mangalore, India
| |
Collapse
|
|
16
|
Siu MT, Weksberg R. Epigenetics of Autism Spectrum Disorder. ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY 2017; 978:63-90. [PMID: 28523541 DOI: 10.1007/978-3-319-53889-1_4] [Citation(s) in RCA: 45] [Impact Index Per Article: 5.6] [Reference Citation Analysis] [Abstract] [Key Words] [Subscribe] [Scholar Register] [Indexed: 12/13/2022]
Abstract
Autism spectrum disorder (ASD), one of the most common childhood neurodevelopmental disorders (NDDs), is diagnosed in 1 of every 68 children. ASD is incredibly heterogeneous both clinically and aetiologically. The etiopathogenesis of ASD is known to be complex, including genetic, environmental and epigenetic factors. Normal epigenetic marks modifiable by both genetics and environmental exposures can result in epigenetic alterations that disrupt the regulation of gene expression, negatively impacting biological pathways important for brain development. In this chapter we aim to summarize some of the important literature that supports a role for epigenetics in the underlying molecular mechanism of ASD. We provide evidence from work in genetics, from environmental exposures and finally from more recent studies aimed at directly determining ASD-specific epigenetic patterns, focusing mainly on DNA methylation (DNAm). Finally, we briefly discuss some of the implications of current research on potential epigenetic targets for therapeutics and novel avenues for future work.
Collapse
Affiliation(s)
- Michelle T Siu
- Program in Genetics and Genome Biology, The Hospital for Sick Children, 555 University Ave, Toronto, ON, M5G 1X8, Canada
| | - Rosanna Weksberg
- Program in Genetics and Genome Biology, The Hospital for Sick Children, 555 University Ave, Toronto, ON, M5G 1X8, Canada. .,Division of Clinical and Metabolic Genetics, The Hospital for Sick Children, 555 University Ave, Toronto, ON, M5G 1X8, Canada. .,Department of Paediatrics, University of Toronto, Toronto, ON, M5S 1A1, Canada. .,Institute of Medical Science, University of Toronto, Toronto, ON, M5S 1A8, Canada.
| |
Collapse
|
|
17
|
Pandey S, Pruitt K. Functional assessment of MeCP2 in Rett syndrome and cancers of breast, colon, and prostate. Biochem Cell Biol 2017; 95:368-378. [DOI: 10.1139/bcb-2016-0154] [Citation(s) in RCA: 7] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 02/05/2023] Open
Abstract
Ever since the first report that mutations in methyl-CpG-binding protein 2 (MeCP2) causes Rett syndrome (RTT), a severe neurological disorder in females world-wide, there has been a keen interest to gain a comprehensive understanding of this protein. While the classical model associated with MeCP2 function suggests its role in gene suppression via recruitment of co-repressor complexes and histone deacetylases to methylated CpG-sites, recent discoveries have brought to light its role in transcription activation, modulation of RNA splicing, and chromatin compaction. Various post-translational modifications (PTMs) of MeCP2 further increase its functional versatility. Involvement of MeCP2 in pathologies other than RTT, such as tumorigenesis however, remains poorly explored and understood. This review provides a survey of the literature implicating MeCP2 in breast, colon and prostate cancer.
Collapse
Affiliation(s)
- Somnath Pandey
- Immunology and Molecular Microbiology, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, TX 79430, USA
- Immunology and Molecular Microbiology, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, TX 79430, USA
| | - Kevin Pruitt
- Immunology and Molecular Microbiology, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, TX 79430, USA
- Immunology and Molecular Microbiology, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, TX 79430, USA
| |
Collapse
|
|
18
|
Stevens AJ, Rucklidge JJ, Kennedy MA. Epigenetics, nutrition and mental health. Is there a relationship? Nutr Neurosci 2017; 21:602-613. [PMID: 28553986 DOI: 10.1080/1028415x.2017.1331524] [Citation(s) in RCA: 19] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/12/2022]
Abstract
Many aspects of human development and disease are influenced by the interaction between genetic and environmental factors. Understanding how our genes respond to the environment is central to managing health and disease, and is one of the major contemporary challenges in human genetics. Various epigenetic processes affect chromosome structure and accessibility of deoxyribonucleic acid (DNA) to the enzymatic machinery that leads to expression of genes. One important epigenetic mechanism that appears to underlie the interaction between environmental factors, including diet, and our genome, is chemical modification of the DNA. The best understood of these modifications is methylation of cytosine residues in DNA. It is now recognized that the pattern of methylated cytosines throughout our genomes (the 'methylome') can change during development and in response to environmental cues, often with profound effects on gene expression. Many dietary constituents may indirectly influence genomic pathways that methylate DNA, and there is evidence for biochemical links between nutritional quality and mental health. Deficiency of both macro- and micronutrients has been associated with increased behavioural problems, and nutritional supplementation has proven efficacious in treatment of certain neuropsychiatric disorders. In this review we examine evidence from the fields of nutrition, developmental biology, and mental health that supports dietary impacts on epigenetic processes, particularly DNA methylation. We then consider whether such processes could underlie the demonstrated efficacy of dietary supplementation in treatment of mental disorders, and whether targeted manipulation of DNA methylation patterns using controlled dietary supplementation may be of wider clinical value.
Collapse
Affiliation(s)
- Aaron J Stevens
- a Department of Pathology , University of Otago , P.O. Box 4345, Christchurch , New Zealand
| | - Julia J Rucklidge
- b Department of Psychology , University of Canterbury , Christchurch , New Zealand
| | - Martin A Kennedy
- a Department of Pathology , University of Otago , P.O. Box 4345, Christchurch , New Zealand
| |
Collapse
|
|
19
|
Dziwota E, Fałkowska U, Adamczyk K, Adamczyk D, Stefańska A, Pawęzka J, Olajossy M. Silent angels the genetic and clinical aspects of Rett syndrome. CURRENT PROBLEMS OF PSYCHIATRY 2016. [DOI: 10.1515/cpp-2016-0028] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/15/2022] Open
Abstract
Abstract
Rett syndrome is a neurodevelopmental genetic disorder and, because of some behavioral characteristics, individuals affected by the disease are known as silent angels. Girls with Rett syndrome perform stereotyped movements, they have learning difficulties, their reaction time is prolonged, and they seem alienated in the environment. These children require constant pediatric, neurological and orthopedic care. In the treatment of Rett syndrome physical therapy, music therapy, hydrotherapy, hippotherapy, behavioral methods, speech therapy and diet, are also used. In turn, psychological therapy of the syndrome is based on the sensory integration method, using two or more senses simultaneously. In 80% of cases, the syndrome is related to mutations of the MECP2 gene, located on chromosome X. The pathogenesis of Rett syndrome is caused by the occurrence of a non-functional MeCP2 protein, which is a transcription factor of many genes, i.e. Bdnf, mef2c, Sgk1, Uqcrc1. Abnormal expression of these genes reveals a characteristic disease phenotype. Clinical symptoms relate mainly to the nervous, respiratory, skeletal and gastrointestinal systems. Currently causal treatment is not possible. However, researchers are developing methods by which, perhaps in the near future, it will be possible to eliminate the mutations in the MECP2 gene, and this will give a chance to the patient for normal functioning.
The paper presents the etiology and pathogenesis of the disease, genetic, clinical, pharmacological aspects and other forms of Rett syndrome treatment.
Collapse
Affiliation(s)
- Ewelina Dziwota
- Second Department of Psychiatry and Psychiatric Rehabilitation, Department of Psychiatry at the Medical University of Lublin
| | - Urszula Fałkowska
- Students Scientific Society at the Second Department of Psychiatry and Psychiatric Rehabilitation
| | - Katarzyna Adamczyk
- Students Scientific Society at the Second Department of Psychiatry and Psychiatric Rehabilitation
| | - Dorota Adamczyk
- Students Scientific Society at the Second Department of Psychiatry and Psychiatric Rehabilitation
| | - Alena Stefańska
- Department of Clinical Psychology and Cardiology, Medical University, Lublin
| | - Justyna Pawęzka
- Second Department of Psychiatry and Psychiatric Rehabilitation, Department of Psychiatry at the Medical University of Lublin
| | - Marcin Olajossy
- Second Department of Psychiatry and Psychiatric Rehabilitation, Department of Psychiatry at the Medical University of Lublin
| |
Collapse
|
|
20
|
Abstract
Autism is a complex neurodevelopmental disorder, which has captured the attention of not only pediatricians but also the parents. From the symptoms until the final diagnosis, parents undergo a diagnostic odyssey that involves a battery of tests without much yield. This has led to an increase in the referrals to the clinical geneticists to rule out the possible genetic etiology that can have implications for the parents for future pregnancy. This chapter focuses on the various genetic causes and their appropriate application in the evaluation of a child with Autism Spectrum Disorders (ASDs).
Collapse
Affiliation(s)
- Shruthi Sudarshan
- Division of Genetics, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India
| | - Neerja Gupta
- Division of Genetics, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India.
| | - Madhulika Kabra
- Division of Genetics, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India
| |
Collapse
|
|
21
|
Veeraragavan S, Wan YW, Connolly DR, Hamilton SM, Ward CS, Soriano S, Pitcher MR, McGraw CM, Huang SG, Green JR, Yuva LA, Liang AJ, Neul JL, Yasui DH, LaSalle JM, Liu Z, Paylor R, Samaco RC. Loss of MeCP2 in the rat models regression, impaired sociability and transcriptional deficits of Rett syndrome. Hum Mol Genet 2016; 25:3284-3302. [PMID: 27365498 PMCID: PMC5179927 DOI: 10.1093/hmg/ddw178] [Citation(s) in RCA: 45] [Impact Index Per Article: 5.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/04/2016] [Revised: 05/18/2016] [Accepted: 06/08/2016] [Indexed: 01/31/2023] Open
Abstract
Mouse models of the transcriptional modulator Methyl-CpG-Binding Protein 2 (MeCP2) have advanced our understanding of Rett syndrome (RTT). RTT is a 'prototypical' neurodevelopmental disorder with many clinical features overlapping with other intellectual and developmental disabilities (IDD). Therapeutic interventions for RTT may therefore have broader applications. However, the reliance on the laboratory mouse to identify viable therapies for the human condition may present challenges in translating findings from the bench to the clinic. In addition, the need to identify outcome measures in well-chosen animal models is critical for preclinical trials. Here, we report that a novel Mecp2 rat model displays high face validity for modelling psychomotor regression of a learned skill, a deficit that has not been shown in Mecp2 mice. Juvenile play, a behavioural feature that is uniquely present in rats and not mice, is also impaired in female Mecp2 rats. Finally, we demonstrate that evaluating the molecular consequences of the loss of MeCP2 in both mouse and rat may result in higher predictive validity with respect to transcriptional changes in the human RTT brain. These data underscore the similarities and differences caused by the loss of MeCP2 among divergent rodent species which may have important implications for the treatment of individuals with disease-causing MECP2 mutations. Taken together, these findings demonstrate that the Mecp2 rat model is a complementary tool with unique features for the study of RTT and highlight the potential benefit of cross-species analyses in identifying potential disease-relevant preclinical outcome measures.
Collapse
Affiliation(s)
- Surabi Veeraragavan
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Ying-Wooi Wan
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Daniel R Connolly
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | | | - Christopher S Ward
- Department of Pediatrics, Section of Neurology
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Sirena Soriano
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Meagan R Pitcher
- Program in Translational Biology and Molecular Medicine
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Christopher M McGraw
- Medical Scientist Training Program, Baylor College of Medicine, Houston, TX, USA
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Sharon G Huang
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | | | - Lisa A Yuva
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Agnes J Liang
- Department of Molecular and Human Genetics
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Jeffrey L Neul
- Department of Pediatrics, Section of Neurology
- Program in Translational Biology and Molecular Medicine
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | - Dag H Yasui
- Rowe Program in Human Genetics, University of California Davis, Davis, CA, USA
| | - Janine M LaSalle
- Rowe Program in Human Genetics, University of California Davis, Davis, CA, USA
| | - Zhandong Liu
- Department of Pediatrics, Section of Neurology
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| | | | - Rodney C Samaco
- Department of Molecular and Human Genetics
- Program in Translational Biology and Molecular Medicine
- Jan and Dan Duncan Neurological Research Institute, Texas Children's Hospital, Houston, TX, USA
| |
Collapse
|
|
22
|
Paternain L, Martisova E, Campión J, Martínez JA, Ramírez MJ, Milagro FI. Methyl donor supplementation in rats reverses the deleterious effect of maternal separation on depression-like behaviour. Behav Brain Res 2015; 299:51-8. [PMID: 26628207 DOI: 10.1016/j.bbr.2015.11.031] [Citation(s) in RCA: 44] [Impact Index Per Article: 4.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/07/2015] [Revised: 11/17/2015] [Accepted: 11/21/2015] [Indexed: 12/22/2022]
Abstract
Adverse early life events are associated with altered stress responsiveness and metabolic disturbances in the adult life. Dietary methyl donor supplementation could be able to reverse the negative effects of maternal separation by affecting DNA methylation in the brain. In this study, maternal separation during lactation reduced body weight gain in the female adult offspring without affecting food intake, and altered total and HDL-cholesterol levels. Also, maternal separation induced a cognitive deficit as measured by NORT and an increase in the immobility time in the Porsolt forced swimming test, consistent with increased depression-like behaviour. An 18-week dietary supplementation with methyl donors (choline, betaine, folate and vitamin B12) from postnatal day 60 also reduced body weight without affecting food intake. Some of the deleterious effects induced by maternal separation, such as the abnormal levels of total and HDL-cholesterol, but especially the depression-like behaviour as measured by the Porsolt test, were reversed by methyl donor supplementation. Also, the administration of methyl donors increased total DNA methylation (measured by immunohistochemistry) and affected the expression of insulin receptor in the hippocampus of the adult offspring. However, no changes were observed in the DNA methylation status of insulin receptor and corticotropin-releasing hormone (CRH) promoter regions in the hypothalamus. In summary, methyl donor supplementation reversed some of the deleterious effects of an early life-induced model of depression in rats and altered the DNA methylation profile in the brain.
Collapse
Affiliation(s)
- Laura Paternain
- Department of Nutrition, Food Science and Physiology, Centre for Nutrition Research, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain
| | - Eva Martisova
- Department of Pharmacology and Toxicology, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain
| | - Javier Campión
- Department of Nutrition, Food Science and Physiology, Centre for Nutrition Research, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain; CIBERobn, Centro de Investigación Biomédica en Red de la Fisiopatología de la Obesidad y Nutrición, Carlos III Health Institute, Madrid, Spain
| | - J Alfredo Martínez
- Department of Nutrition, Food Science and Physiology, Centre for Nutrition Research, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain; CIBERobn, Centro de Investigación Biomédica en Red de la Fisiopatología de la Obesidad y Nutrición, Carlos III Health Institute, Madrid, Spain; IDISNA, Navarra's Health Research Institute, Pamplona, Spain
| | - Maria J Ramírez
- Department of Pharmacology and Toxicology, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain; IDISNA, Navarra's Health Research Institute, Pamplona, Spain.
| | - Fermin I Milagro
- Department of Nutrition, Food Science and Physiology, Centre for Nutrition Research, University of Navarra, c/Irunlarrea 1, 31008 Pamplona, Spain; CIBERobn, Centro de Investigación Biomédica en Red de la Fisiopatología de la Obesidad y Nutrición, Carlos III Health Institute, Madrid, Spain
| |
Collapse
|
|
23
|
Modeling non-syndromic autism and the impact of TRPC6 disruption in human neurons. Mol Psychiatry 2015; 20:1350-65. [PMID: 25385366 PMCID: PMC4427554 DOI: 10.1038/mp.2014.141] [Citation(s) in RCA: 151] [Impact Index Per Article: 15.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 03/24/2014] [Revised: 09/15/2014] [Accepted: 09/17/2014] [Indexed: 01/01/2023]
Abstract
An increasing number of genetic variants have been implicated in autism spectrum disorders (ASDs), and the functional study of such variants will be critical for the elucidation of autism pathophysiology. Here, we report a de novo balanced translocation disruption of TRPC6, a cation channel, in a non-syndromic autistic individual. Using multiple models, such as dental pulp cells, induced pluripotent stem cell (iPSC)-derived neuronal cells and mouse models, we demonstrate that TRPC6 reduction or haploinsufficiency leads to altered neuronal development, morphology and function. The observed neuronal phenotypes could then be rescued by TRPC6 complementation and by treatment with insulin-like growth factor-1 or hyperforin, a TRPC6-specific agonist, suggesting that ASD individuals with alterations in this pathway may benefit from these drugs. We also demonstrate that methyl CpG binding protein-2 (MeCP2) levels affect TRPC6 expression. Mutations in MeCP2 cause Rett syndrome, revealing common pathways among ASDs. Genetic sequencing of TRPC6 in 1041 ASD individuals and 2872 controls revealed significantly more nonsynonymous mutations in the ASD population, and identified loss-of-function mutations with incomplete penetrance in two patients. Taken together, these findings suggest that TRPC6 is a novel predisposing gene for ASD that may act in a multiple-hit model. This is the first study to use iPSC-derived human neurons to model non-syndromic ASD and illustrate the potential of modeling genetically complex sporadic diseases using such cells.
Collapse
|
|
24
|
McGowan H, Pang ZP. Regulatory functions and pathological relevance of the MECP2 3'UTR in the central nervous system. CELL REGENERATION 2015; 4:9. [PMID: 26516454 PMCID: PMC4625459 DOI: 10.1186/s13619-015-0023-x] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 05/01/2015] [Accepted: 09/18/2015] [Indexed: 11/10/2022]
Abstract
Methyl-CpG-binding protein 2 (MeCP2), encoded by the gene MECP2, is a transcriptional regulator and chromatin-remodeling protein, which is ubiquitously expressed and plays an essential role in the development and maintenance of the central nervous system (CNS). Highly enriched in post-migratory neurons, MeCP2 is needed for neuronal maturation, including dendritic arborization and the development of synapses. Loss-of-function mutations in MECP2 cause Rett syndrome (RTT), a debilitating neurodevelopmental disorder characterized by a phase of normal development, followed by the progressive loss of milestones and cognitive disability. While a great deal has been discovered about the structure, function, and regulation of MeCP2 in the time since its discovery as the genetic cause of RTT, including its involvement in a number of RTT-related syndromes that have come to be known as MeCP2-spectrum disorders, much about this multifunctional protein remains enigmatic. One unequivocal fact that has become apparent is the importance of maintaining MeCP2 protein levels within a narrow range, the limits of which may depend upon the cell type and developmental time point. As such, MeCP2 is amenable to complex, multifactorial regulation. Here, we summarize the role of the MECP2 3' untranslated region (UTR) in the regulation of MeCP2 protein levels and how mutations in this region contribute to autism and other non-RTT neuropsychiatric disorders.
Collapse
Affiliation(s)
- Heather McGowan
- Department of Neuroscience and Cell Biology, Child Health Institute of New Jersey, Rutgers University Robert Wood Johnson Medical School, 89 French Street, Room 3277, New Brunswick, NJ 08901 USA
| | - Zhiping P Pang
- Department of Neuroscience and Cell Biology, Child Health Institute of New Jersey, Rutgers University Robert Wood Johnson Medical School, 89 French Street, Room 3277, New Brunswick, NJ 08901 USA
| |
Collapse
|
|
25
|
Merner ND, Chandler MR, Bourassa C, Liang B, Khanna AR, Dion P, Rouleau GA, Kahle KT. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia. Front Cell Neurosci 2015; 9:386. [PMID: 26528127 PMCID: PMC4600830 DOI: 10.3389/fncel.2015.00386] [Citation(s) in RCA: 72] [Impact Index Per Article: 7.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/12/2015] [Accepted: 09/16/2015] [Indexed: 12/23/2022] Open
Abstract
Many encoded gene products responsible for neurodevelopmental disorders (NDs) like autism spectrum disorders (ASD), schizophrenia (SCZ), intellectual disability (ID), and idiopathic generalized epilepsy (IGE) converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5) Cl− transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS), functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD) in human ASD (R952H and R1049C) and SCZ (R952H) previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W) with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection (SSC) revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.
Collapse
Affiliation(s)
- Nancy D Merner
- Harrison School of Pharmacy, Department of Drug Discovery and Development, Auburn University Auburn, AL, USA ; Department of Neurology and Neurosurgery, Montreal Neurological Hospital and Institute, McGill University Montréal, QC, Canada
| | - Madison R Chandler
- Harrison School of Pharmacy, Department of Drug Discovery and Development, Auburn University Auburn, AL, USA
| | - Cynthia Bourassa
- Department of Neurology and Neurosurgery, Montreal Neurological Hospital and Institute, McGill University Montréal, QC, Canada
| | - Bo Liang
- Department of Biological Chemistry and Molecular Pharmacology (BCMP), Harvard Medical School Boston, MA, USA
| | - Arjun R Khanna
- Department of Neurosurgery, Boston Children's Hospital and Harvard Medical School Boston, MA, USA
| | - Patrick Dion
- Department of Neurology and Neurosurgery, Montreal Neurological Hospital and Institute, McGill University Montréal, QC, Canada
| | - Guy A Rouleau
- Department of Neurology and Neurosurgery, Montreal Neurological Hospital and Institute, McGill University Montréal, QC, Canada
| | - Kristopher T Kahle
- Department of Neurosurgery, Boston Children's Hospital and Harvard Medical School Boston, MA, USA ; Manton Center for Orphan Disease Research, Boston Children's Hospital Boston, MA, USA
| |
Collapse
|
|
26
|
Hua R, Wei M, Zhang C. The complex genetics in autism spectrum disorders. SCIENCE CHINA-LIFE SCIENCES 2015; 58:933-45. [PMID: 26335739 DOI: 10.1007/s11427-015-4893-5] [Citation(s) in RCA: 3] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 10/23/2022]
Abstract
Autism spectrum disorders (ASD) are a pervasive neurodevelopmental disease characterized by deficits in social interaction and nonverbal communication, as well as restricted interests and stereotypical behavior. Genetic changes/heritability is one of the major contributing factors, and hundreds to thousands of causative and susceptible genes, copy number variants (CNVs), linkage regions, and microRNAs have been associated with ASD which clearly indicates that ASD is a complex genetic disorder. Here, we will briefly summarize some of the high-confidence genetic changes in ASD and their possible roles in their pathogenesis.
Collapse
Affiliation(s)
- Rui Hua
- State Key Laboratory of Membrane Biology, School of Life Sciences; PKU-IDG/McGovern Institute for Brain Research, Peking University, Beijing, 100871, China
| | - MengPing Wei
- State Key Laboratory of Membrane Biology, School of Life Sciences; PKU-IDG/McGovern Institute for Brain Research, Peking University, Beijing, 100871, China
| | - Chen Zhang
- State Key Laboratory of Membrane Biology, School of Life Sciences; PKU-IDG/McGovern Institute for Brain Research, Peking University, Beijing, 100871, China.
| |
Collapse
|
|
27
|
Wong VCN, Fung CW, Lee SL, Wong PTY. Review of evolution of clinical, training and educational services and research program for autism spectrum disorders in Hong Kong. SCIENCE CHINA-LIFE SCIENCES 2015; 58:991-1009. [PMID: 26335731 DOI: 10.1007/s11427-012-4294-y] [Citation(s) in RCA: 8] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 11/25/2022]
Abstract
The evolution of a local fragmented model of services for children with autism in Hong Kong emerged gradually over the past three decades with lack of government funding or support. This had been due to increasing number of children with autism being detected and referred for earlier assessment. With increasing pressure from parents due to long waiting time for assessment and training services and the increasing polarization by mass media there had been a gradual increasing public awareness over the past five years. Though still highly fragmented in the availability of services, there is a growing "business model" available in the community due to increasing need and lack of public funding for support. There is a lack of strategic planning for medical diagnostic and management issues in Hong Kong. Our University of Hong Kong based Autism Research Program was pioneered in 1985 based on the increasing load of autism cases referred for assessment for other developmental problems and diagnosed as Autism in the Duchess of Kent Children's Hospital. As the first author has been the staff of the University of Hong Kong, this program flourished as a research based program. The benefits of early identification and intervention of autism spectrum disorder (ASD) had been increasingly recognized, and with the increased public awareness and increasing trend of earlier diagnosis, there has been a continuously high demand from parents for earlier assessment and training for children suspected to have ASD. This model had not received extra funding for this integrated program for research, teaching and training in autism. We had to apply for various donations and grants to support the development of this pioneer program. The research output and organization of forums for public education and awareness are reviewed. The latter part of the paper reports the summary of clinical profile of autism cases (N=1441) assessed from 1985 to 2010 June under the University of Hong Kong. As the waiting time for initial developmental assessment for any children in Hong Kong is 12-24 months, we also report our preliminary experience with a newly launched triaging service provision for children suspected to be ASD since 2009, including multi-disciplinary assessment and parallel interim training in our university affiliated child assessment centre in Hong (N=89).
Collapse
Affiliation(s)
- Virginia Chun-Nei Wong
- Department of Paediatrics and Adolescent Medicine, the University of Hong Kong, Queen Mary Hospital, Hong Kong, China.
| | - Cheuk-Wing Fung
- Department of Paediatrics and Adolescent Medicine, the University of Hong Kong, Queen Mary Hospital, Hong Kong, China
| | - So-Lun Lee
- Department of Paediatrics and Adolescent Medicine, the University of Hong Kong, Queen Mary Hospital, Hong Kong, China
| | - Polly Tsz Yan Wong
- Department of Paediatrics and Adolescent Medicine, the University of Hong Kong, Queen Mary Hospital, Hong Kong, China
| |
Collapse
|
|
28
|
Tsujimura K, Irie K, Nakashima H, Egashira Y, Fukao Y, Fujiwara M, Itoh M, Uesaka M, Imamura T, Nakahata Y, Yamashita Y, Abe T, Takamori S, Nakashima K. miR-199a Links MeCP2 with mTOR Signaling and Its Dysregulation Leads to Rett Syndrome Phenotypes. Cell Rep 2015; 12:1887-901. [PMID: 26344767 DOI: 10.1016/j.celrep.2015.08.028] [Citation(s) in RCA: 72] [Impact Index Per Article: 7.2] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/02/2013] [Revised: 06/06/2015] [Accepted: 08/08/2015] [Indexed: 01/03/2023] Open
Abstract
Rett syndrome (RTT) is a neurodevelopmental disorder caused by MECP2 mutations. Although emerging evidence suggests that MeCP2 deficiency is associated with dysregulation of mechanistic target of rapamycin (mTOR), which functions as a hub for various signaling pathways, the mechanism underlying this association and the molecular pathophysiology of RTT remain elusive. We show here that MeCP2 promotes the posttranscriptional processing of particular microRNAs (miRNAs) as a component of the microprocessor Drosha complex. Among the MeCP2-regulated miRNAs, we found that miR-199a positively controls mTOR signaling by targeting inhibitors for mTOR signaling. miR-199a and its targets have opposite effects on mTOR activity, ameliorating and inducing RTT neuronal phenotypes, respectively. Furthermore, genetic deletion of miR-199a-2 led to a reduction of mTOR activity in the brain and recapitulated numerous RTT phenotypes in mice. Together, these findings establish miR-199a as a critical downstream target of MeCP2 in RTT pathogenesis by linking MeCP2 with mTOR signaling.
Collapse
Affiliation(s)
- Keita Tsujimura
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan; Laboratory of Molecular Neuroscience, Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan
| | - Koichiro Irie
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan
| | - Hideyuki Nakashima
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan
| | - Yoshihiro Egashira
- Laboratory of Neural Membrane Biology, Graduate School of Brain Science, Doshisha University, 1-3 Miyakodani, Tatara, Kyotanabe, Kyoto 610-0394, Japan
| | - Yoichiro Fukao
- Plant Global Education Project, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan; Department of Bioinformatics, Ritsumeikan University, Kusatsu, Shiga 525-8577, Japan
| | - Masayuki Fujiwara
- Plant Global Education Project, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan; Institute for Advanced Biosciences, Keio University, Tsuruoka, Yamagata 997-0017, Japan
| | - Masayuki Itoh
- Department of Mental Retardation and Birth Defect Research, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan
| | - Masahiro Uesaka
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan
| | - Takuya Imamura
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan
| | - Yasukazu Nakahata
- Laboratory of Gene Regulation Research, Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan
| | - Yui Yamashita
- Animal Resource Development Unit, RIKEN Center for Life Science Technologies, 2-2-3 Minatojima Minami-machi, Chuou-ku, Kobe 650-0047, Japan
| | - Takaya Abe
- Genetic Engineering Team, RIKEN Center for Life Science Technologies, 2-2-3 Minatojima Minami-machi, Chuou-ku, Kobe 650-0047, Japan
| | - Shigeo Takamori
- Laboratory of Neural Membrane Biology, Graduate School of Brain Science, Doshisha University, 1-3 Miyakodani, Tatara, Kyotanabe, Kyoto 610-0394, Japan
| | - Kinichi Nakashima
- Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan; Laboratory of Molecular Neuroscience, Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan.
| |
Collapse
|
|
29
|
KhorshidAhmad T, Acosta C, Cortes C, Lakowski TM, Gangadaran S, Namaka M. Transcriptional Regulation of Brain-Derived Neurotrophic Factor (BDNF) by Methyl CpG Binding Protein 2 (MeCP2): a Novel Mechanism for Re-Myelination and/or Myelin Repair Involved in the Treatment of Multiple Sclerosis (MS). Mol Neurobiol 2015; 53:1092-1107. [PMID: 25579386 DOI: 10.1007/s12035-014-9074-1] [Citation(s) in RCA: 52] [Impact Index Per Article: 5.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/24/2014] [Accepted: 12/29/2014] [Indexed: 12/13/2022]
Abstract
Multiple sclerosis (MS) is a chronic progressive, neurological disease characterized by the targeted immune system-mediated destruction of central nervous system (CNS) myelin. Autoreactive CD4+ T helper cells have a key role in orchestrating MS-induced myelin damage. Once activated, circulating Th1-cells secrete a variety of inflammatory cytokines that foster the breakdown of blood-brain barrier (BBB) eventually infiltrating into the CNS. Inside the CNS, they become reactivated upon exposure to the myelin structural proteins and continue to produce inflammatory cytokines such as tumor necrosis factor α (TNFα) that leads to direct activation of antibodies and macrophages that are involved in the phagocytosis of myelin. Proliferating oligodendrocyte precursors (OPs) migrating to the lesion sites are capable of acute remyelination but unable to completely repair or restore the immune system-mediated myelin damage. This results in various permanent clinical neurological disabilities such as cognitive dysfunction, fatigue, bowel/bladder abnormalities, and neuropathic pain. At present, there is no cure for MS. Recent remyelination and/or myelin repair strategies have focused on the role of the neurotrophin brain-derived neurotrophic factor (BDNF) and its upstream transcriptional repressor methyl CpG binding protein (MeCP2). Research in the field of epigenetic therapeutics involving histone deacetylase (HDAC) inhibitors and lysine acetyl transferase (KAT) inhibitors is being explored to repress the detrimental effects of MeCP2. This review will address the role of MeCP2 and BDNF in remyelination and/or myelin repair and the potential of HDAC and KAT inhibitors as novel therapeutic interventions for MS.
Collapse
Affiliation(s)
- Tina KhorshidAhmad
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada.,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada
| | - Crystal Acosta
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada.,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada
| | - Claudia Cortes
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada.,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada
| | - Ted M Lakowski
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada.,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada
| | - Surendiran Gangadaran
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada.,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada
| | - Michael Namaka
- College of Pharmacy, University of Manitoba, 750 McDermot Avenue, Winnipeg, R3E 0T5, Manitoba, Canada. .,Manitoba Multiple Sclerosis Research Network Organization (MMSRNO), Winnipeg, Canada. .,College of Medicine, University of Manitoba, Winnipeg, Canada. .,School of Medical Rehabilitation, College of Medicine, University of Manitoba, Winnipeg, Canada.
| |
Collapse
|
|
30
|
Oviedo N, Manuel-Apolinar L, de la Chesnaye E, Guerra-Araiza C. [Genetic and neuroendocrine aspects in autism spectrum disorder]. BOLETIN MEDICO DEL HOSPITAL INFANTIL DE MEXICO 2015; 72:5-14. [PMID: 29421180 DOI: 10.1016/j.bmhimx.2015.01.010] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/27/2014] [Revised: 12/05/2014] [Accepted: 01/15/2015] [Indexed: 10/23/2022] Open
Abstract
The autism spectrum disorder (ASD) was described in 1943 and is defined as a developmental disorder that affects social interaction and communication. It is usually identified in early stages of development from 18 months of age. Currently, autism is considered a neurological disorder with a spectrum covering cases of different degrees, which is associated with genetic factors, not genetic and environmental. Among the genetic factors, various syndromes have been described that are associated with this disorder. Also, the neurobiology of autism has been studied at the genetic, neurophysiological, neurochemical and neuropathological levels. Neuroimaging techniques have shown multiple structural abnormalities in these patients. There have also been changes in the serotonergic, GABAergic, catecholaminergic and cholinergic systems related to this disorder. This paper presents an update of the information presented in the genetic and neuroendocrine aspects of autism spectrum disorder.
Collapse
Affiliation(s)
- Norma Oviedo
- Unidad de Investigación Médica en Enfermedades Metabólicas, Hospital de Cardiología, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México D.F., México
| | - Leticia Manuel-Apolinar
- Unidad de Investigación Médica en Enfermedades Endocrinas, Hospital de Especialidades, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México D.F., México
| | - Elsa de la Chesnaye
- Unidad de Investigación Médica en Enfermedades Metabólicas, Hospital de Cardiología, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México D.F., México
| | - Christian Guerra-Araiza
- Unidad de Investigación Médica en Farmacología, Hospital de Especialidades Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México D.F., México.
| |
Collapse
|
|
31
|
Liyanage VRB, Jarmasz JS, Murugeshan N, Del Bigio MR, Rastegar M, Davie JR. DNA modifications: function and applications in normal and disease States. BIOLOGY 2014; 3:670-723. [PMID: 25340699 PMCID: PMC4280507 DOI: 10.3390/biology3040670] [Citation(s) in RCA: 86] [Impact Index Per Article: 7.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 07/15/2014] [Revised: 09/22/2014] [Accepted: 09/24/2014] [Indexed: 12/12/2022]
Abstract
Epigenetics refers to a variety of processes that have heritable effects on gene expression programs without changes in DNA sequence. Key players in epigenetic control are chemical modifications to DNA, histone, and non-histone chromosomal proteins, which establish a complex regulatory network that controls genome function. Methylation of DNA at the fifth position of cytosine in CpG dinucleotides (5-methylcytosine, 5mC), which is carried out by DNA methyltransferases, is commonly associated with gene silencing. However, high resolution mapping of DNA methylation has revealed that 5mC is enriched in exonic nucleosomes and at intron-exon junctions, suggesting a role of DNA methylation in the relationship between elongation and RNA splicing. Recent studies have increased our knowledge of another modification of DNA, 5-hydroxymethylcytosine (5hmC), which is a product of the ten-eleven translocation (TET) proteins converting 5mC to 5hmC. In this review, we will highlight current studies on the role of 5mC and 5hmC in regulating gene expression (using some aspects of brain development as examples). Further the roles of these modifications in detection of pathological states (type 2 diabetes, Rett syndrome, fetal alcohol spectrum disorders and teratogen exposure) will be discussed.
Collapse
Affiliation(s)
- Vichithra R B Liyanage
- Department of Biochemistry and Medical Genetics, Manitoba Institute of Cell Biology, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| | - Jessica S Jarmasz
- Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| | - Nanditha Murugeshan
- Department of Biochemistry and Medical Genetics, Manitoba Institute of Cell Biology, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| | - Marc R Del Bigio
- Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| | - Mojgan Rastegar
- Department of Biochemistry and Medical Genetics, Manitoba Institute of Cell Biology, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| | - James R Davie
- Department of Biochemistry and Medical Genetics, Manitoba Institute of Cell Biology, University of Manitoba, Winnipeg, MB R3E 0J9, Canada.
| |
Collapse
|
|
32
|
Heckman LD, Chahrour MH, Zoghbi HY. Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice. eLife 2014; 3. [PMID: 24970834 PMCID: PMC4102243 DOI: 10.7554/elife.02676] [Citation(s) in RCA: 62] [Impact Index Per Article: 5.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/28/2014] [Accepted: 06/25/2014] [Indexed: 11/13/2022] Open
Abstract
Loss of function of the X-linked gene encoding methyl-CpG binding protein 2 (MeCP2) causes the progressive neurological disorder Rett syndrome (RTT). Conversely, duplication or triplication of Xq28 causes an equally wide-ranging progressive neurological disorder, MECP2 duplication syndrome, whose features overlap somewhat with RTT. To understand which MeCP2 functions cause toxicity in the duplication syndrome, we generated mouse models expressing endogenous Mecp2 along with a RTT-causing mutation in either the methyl-CpG binding domain (MBD) or the transcriptional repression domain (TRD). We determined that both the MBD and TRD must function for doubling MeCP2 to be toxic. Mutating the MBD reproduces the null phenotype and expressing the TRD mutant produces milder RTT phenotypes, yet both mutations are harmless when expressed with endogenous Mecp2. Surprisingly, mutating the TRD is more detrimental than deleting the entire C-terminus, indicating a dominant-negative effect on MeCP2 function, likely due to the disruption of a basic cluster.
Collapse
Affiliation(s)
- Laura Dean Heckman
- Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, United States
| | - Maria H Chahrour
- Division of Genetics, Department of Medicine, Harvard Medical School, Boston, United States
| | - Huda Y Zoghbi
- Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, United States
| |
Collapse
|
|
33
|
Abstract
Rett syndrome (RTT) is a severe and progressive neurological disorder, which mainly affects young females. Mutations of the methyl-CpG binding protein 2 (MECP2) gene are the most prevalent cause of classical RTT cases. MECP2 mutations or altered expression are also associated with a spectrum of neurodevelopmental disorders such as autism spectrum disorders with recent links to fetal alcohol spectrum disorders. Collectively, MeCP2 relation to these neurodevelopmental disorders highlights the importance of understanding the molecular mechanisms by which MeCP2 impacts brain development, mental conditions, and compromised brain function. Since MECP2 mutations were discovered to be the primary cause of RTT, a significant progress has been made in the MeCP2 research, with respect to the expression, function and regulation of MeCP2 in the brain and its contribution in RTT pathogenesis. To date, there have been intensive efforts in designing effective therapeutic strategies for RTT benefiting from mouse models and cells collected from RTT patients. Despite significant progress in MeCP2 research over the last few decades, there is still a knowledge gap between the in vitro and in vivo research findings and translating these findings into effective therapeutic interventions in human RTT patients. In this review, we will provide a synopsis of Rett syndrome as a severe neurological disorder and will discuss the role of MeCP2 in RTT pathophysiology.
Collapse
|
|
34
|
Talkowski ME, Minikel EV, Gusella JF. Autism spectrum disorder genetics: diverse genes with diverse clinical outcomes. Harv Rev Psychiatry 2014; 22:65-75. [PMID: 24614762 PMCID: PMC9369102 DOI: 10.1097/hrp.0000000000000002] [Citation(s) in RCA: 52] [Impact Index Per Article: 4.7] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 11/26/2022]
Abstract
The last several years have seen unprecedented advances in deciphering the genetic etiology of autism spectrum disorders (ASDs). Heritability studies have repeatedly affirmed a contribution of genetic factors to the overall disease risk. Technical breakthroughs have enabled the search for these genetic factors via genome-wide surveys of a spectrum of potential sequence variations, from common single-nucleotide polymorphisms to essentially private chromosomal abnormalities. Studies of copy-number variation have identified significant roles for both recurrent and nonrecurrent large dosage imbalances, although they have rarely revealed the individual genes responsible. More recently, discoveries of rare point mutations and characterization of balanced chromosomal abnormalities have pinpointed individual ASD genes of relatively strong effect, including both loci with strong a priori biological relevance and those that would have otherwise been unsuspected as high-priority biological targets. Evidence has also emerged for association with many common variants, each adding a small individual contribution to ASD risk. These findings collectively provide compelling empirical data that the genetic basis of ASD is highly heterogeneous, with hundreds of genes capable of conferring varying degrees of risk, depending on their nature and the predisposing genetic alteration. Moreover, many genes that have been implicated in ASD also appear to be risk factors for related neurodevelopmental disorders, as well as for a spectrum of psychiatric phenotypes. While some ASD genes have evident functional significance, like synaptic proteins such as the SHANKs, neuroligins, and neurexins, as well as fragile x mental retardation-associated proteins, ASD genes have also been discovered that do not present a clear mechanism of specific neurodevelopmental dysfunction, such as regulators of chromatin modification and global gene expression. In its sum, the progress from genetic studies to date has been remarkable and increasingly rapid, but the interactive impact of strong-effect genetic lesions coupled with weak-effect common polymorphisms has not yet led to a unified understanding of ASD pathogenesis or explained its highly variable clinical expression. With an increasingly firm genetic foundation, the coming years will hopefully see equally rapid advances in elucidating the functional consequences of ASD genes and their interactions with environmental/experiential factors, supporting the development of rational interventions.
Collapse
Affiliation(s)
- Michael E Talkowski
- From Harvard Medical School (Drs. Talkowski and Gusella); Department of Neurology (Drs. Talkowski and Gusella), Psychiatric and Neurodevelopmental Genetics Unit (Dr. Talkowski) and Molecular Neurogenetics Unit, Center for Human Genetic Research (Drs. Talkowski and Gusella, and Mr. Minikel), Massachusetts General Hospital, Boston, MA
| | | | | |
Collapse
|
|
35
|
Mullin AP, Gokhale A, Moreno-De-Luca A, Sanyal S, Waddington JL, Faundez V. Neurodevelopmental disorders: mechanisms and boundary definitions from genomes, interactomes and proteomes. Transl Psychiatry 2013; 3:e329. [PMID: 24301647 PMCID: PMC4030327 DOI: 10.1038/tp.2013.108] [Citation(s) in RCA: 82] [Impact Index Per Article: 6.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 10/15/2013] [Accepted: 10/22/2013] [Indexed: 02/08/2023] Open
Abstract
Neurodevelopmental disorders such as intellectual disability, autism spectrum disorder and schizophrenia lack precise boundaries in their clinical definitions, epidemiology, genetics and protein-protein interactomes. This calls into question the appropriateness of current categorical disease concepts. Recently, there has been a rising tide to reformulate neurodevelopmental nosological entities from biology upward. To facilitate this developing trend, we propose that identification of unique proteomic signatures that can be strongly associated with patient's risk alleles and proteome-interactome-guided exploration of patient genomes could define biological mechanisms necessary to reformulate disorder definitions.
Collapse
Affiliation(s)
- A P Mullin
- Department of Cell Biology, Emory University School of Medicine, Center for Social Translational Neuroscience, Emory University, Atlanta, GA, USA
| | - A Gokhale
- Department of Cell Biology, Emory University School of Medicine, Center for Social Translational Neuroscience, Emory University, Atlanta, GA, USA
| | - A Moreno-De-Luca
- Autism and Developmental Medicine Institute, Genomic Medicine Institute, Geisinger Health System, Danville, PA, USA
| | - S Sanyal
- Department of Cell Biology, Emory University School of Medicine, Center for Social Translational Neuroscience, Emory University, Atlanta, GA, USA,Biogen-Idec, 14 Cambridge Center, Cambridge, MA, USA
| | - J L Waddington
- Molecular & Cellular Therapeutics, Royal College of Surgeons in Ireland, Dublin, Ireland
| | - V Faundez
- Department of Cell Biology, Emory University School of Medicine, Center for Social Translational Neuroscience, Emory University, Atlanta, GA, USA,Center for Social Translational Neuroscience, Emory University, Atlanta, GA, USA,Department of Cell Biology, Emory University School of Medicine, Center for Social Translational Neuroscience, Emory University, Atlanta, GA 30322, USA. E-mail:
| |
Collapse
|
|
36
|
Waga C, Asano H, Sanagi T, Suzuki E, Nakamura Y, Tsuchiya A, Itoh M, Goto YI, Kohsaka S, Uchino S. Identification of two novel Shank3 transcripts in the developing mouse neocortex. J Neurochem 2013; 128:280-93. [PMID: 24164323 DOI: 10.1111/jnc.12505] [Citation(s) in RCA: 18] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/14/2013] [Revised: 10/02/2013] [Accepted: 10/18/2013] [Indexed: 01/29/2023]
Abstract
SHANK3 is a synaptic scaffolding protein enriched in the post-synaptic density of excitatory synapses. Since several SHANK3 mutations have been identified in a particular phenotypic group of patients with autism spectrum disorder (ASD), SHANK3 is strongly suspected of being involved in the pathogenesis and neuropathology of ASD. Several SHANK3 isoforms are known to be produced in the developing brain, but they have not been fully investigated. Here, we identified two different amino-terminus truncated Shank3 transcripts. One transcript, designated as Shank3c-3, produces an isoform that contains the entire carboxyl-terminus, but the other transcript, designated as Shank3c-4, produces a carboxyl-terminus truncated isoform. During development, expression of the novel Shank3 transcripts increased after birth, transiently decreased at P14 and then gradually increased again thereafter. We also determined that methyl CpG-binding protein 2 (MeCP2) is involved in regulating expression of the novel Shank3 transcripts. MeCP2 is a transcriptional regulator that has been identified as the causative molecule of Rett syndrome, a neurodevelopmental disorder that includes autistic behavior. We demonstrated a difference between the expression of the novel Shank3 transcripts in wild-type mice and Mecp2-deficient mice. These findings suggest that the SHANK3 isoforms may be implicated in the synaptic abnormality in Rett syndrome. SHANK3 is a synaptic scaffolding protein and is suspected of being implicated in the pathogenesis and neuropathology of ASD. We here identified two different amino-terminus truncated Shank3 transcripts, Shank3c-3 and Shank3c-4, expressed from the intron 10 of the Shank3 gene, and also suggested the epigenetic regulation of their expression via methyl CpG-binding protein 2 (MeCP2) that has been identified as the causative molecule of Rett syndrome.
Collapse
Affiliation(s)
- Chikako Waga
- Department of Neurochemistry, National Institute of Neuroscience, Kodaira, Tokyo, Japan; Department of Mental Retardation and Birth Defect Research, National Institute of Neuroscience, Kodaira, Tokyo, Japan
| | | | | | | | | | | | | | | | | | | |
Collapse
|
|
37
|
A role for MeCP2 in switching gene activity via chromatin unfolding and HP1γ displacement. PLoS One 2013; 8:e69347. [PMID: 23935992 PMCID: PMC3720725 DOI: 10.1371/journal.pone.0069347] [Citation(s) in RCA: 11] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/08/2013] [Accepted: 06/07/2013] [Indexed: 11/19/2022] Open
Abstract
Methyl-CpG-binding protein 2 (MeCP2) is generally considered to act as a transcriptional repressor, whereas recent studies suggest that MeCP2 is also involved in transcription activation. To gain insight into this dual function of MeCP2, we assessed the impact of MeCP2 on higher-order chromatin structure in living cells using mammalian cell systems harbouring a lactose operator and reporter gene-containing chromosomal domain to assess the effect of lactose repressor-tagged MeCP2 (and separate MeCP2 domains) binding in living cells. Our data reveal that targeted binding of MeCP2 elicits extensive chromatin unfolding. MeCP2-induced chromatin unfolding is triggered independently of the methyl-cytosine-binding domain. Interestingly, MeCP2 binding triggers the loss of HP1γ at the chromosomal domain and an increased HP1γ mobility, which is not observed for HP1α and HP1β. Surprisingly, MeCP2-induced chromatin unfolding is not associated with transcriptional activation. Our study suggests a novel role for MeCP2 in reorganizing chromatin to facilitate a switch in gene activity.
Collapse
|
|
38
|
Persico AM, Napolioni V. Autism genetics. Behav Brain Res 2013; 251:95-112. [PMID: 23769996 DOI: 10.1016/j.bbr.2013.06.012] [Citation(s) in RCA: 174] [Impact Index Per Article: 14.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/28/2012] [Revised: 06/03/2013] [Accepted: 06/04/2013] [Indexed: 12/22/2022]
Abstract
Autism spectrum disorder (ASD) is a severe neuropsychiatric disease with strong genetic underpinnings. However, genetic contributions to autism are extremely heterogeneous, with many different loci underlying the disease to a different extent in different individuals. Moreover, the phenotypic expression (i.e., "penetrance") of these genetic components is also highly variable, ranging from fully penetrant point mutations to polygenic forms with multiple gene-gene and gene-environment interactions. Furthermore, many genes involved in ASD are also involved in intellectual disability, further underscoring their lack of specificity in phenotypic expression. We shall hereby review current knowledge on the genetic basis of ASD, spanning genetic/genomic syndromes associated with autism, monogenic forms due to copy number variants (CNVs) or rare point mutations, mitochondrial forms, and polygenic autisms. Finally, the recent contributions of genome-wide association and whole exome sequencing studies will be highlighted.
Collapse
Affiliation(s)
- Antonio M Persico
- Child and Adolescent Neuropsychiatry Unit, University Campus Bio-Medico, Rome, Italy.
| | | |
Collapse
|
|
39
|
Larimore J, Ryder PV, Kim KY, Ambrose LA, Chapleau C, Calfa G, Gross C, Bassell GJ, Pozzo-Miller L, Smith Y, Talbot K, Park IH, Faundez V. MeCP2 regulates the synaptic expression of a Dysbindin-BLOC-1 network component in mouse brain and human induced pluripotent stem cell-derived neurons. PLoS One 2013; 8:e65069. [PMID: 23750231 PMCID: PMC3672180 DOI: 10.1371/journal.pone.0065069] [Citation(s) in RCA: 36] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/29/2012] [Accepted: 04/22/2013] [Indexed: 02/06/2023] Open
Abstract
Clinical, epidemiological, and genetic evidence suggest overlapping pathogenic mechanisms between autism spectrum disorder (ASD) and schizophrenia. We tested this hypothesis by asking if mutations in the ASD gene MECP2 which cause Rett syndrome affect the expression of genes encoding the schizophrenia risk factor dysbindin, a subunit of the biogenesis of lysosome-related organelles complex-1 (BLOC-1), and associated interacting proteins. We measured mRNA and protein levels of key components of a dysbindin interaction network by, quantitative real time PCR and quantitative immunohistochemistry in hippocampal samples of wild-type and Mecp2 mutant mice. In addition, we confirmed results by performing immunohistochemistry of normal human hippocampus and quantitative qRT-PCR of human inducible pluripotent stem cells (iPSCs)-derived human neurons from Rett syndrome patients. We defined the distribution of the BLOC-1 subunit pallidin in human and mouse hippocampus and contrasted this distribution with that of symptomatic Mecp2 mutant mice. Neurons from mutant mice and Rett syndrome patients displayed selectively reduced levels of pallidin transcript. Pallidin immunoreactivity decreased in the hippocampus of symptomatic Mecp2 mutant mice, a feature most prominent at asymmetric synapses as determined by immunoelectron microcopy. Pallidin immunoreactivity decreased concomitantly with reduced BDNF content in the hippocampus of Mecp2 mice. Similarly, BDNF content was reduced in the hippocampus of BLOC-1 deficient mice suggesting that genetic defects in BLOC-1 are upstream of the BDNF phenotype in Mecp2 deficient mice. Our results demonstrate that the ASD-related gene Mecp2 regulates the expression of components belonging to the dysbindin interactome and these molecular differences may contribute to synaptic phenotypes that characterize Mecp2 deficiencies and ASD.
Collapse
Affiliation(s)
- Jennifer Larimore
- Department of Biology, Agnes Scott College, Decatur, Georgia, United States of America
| | - Pearl V. Ryder
- Cell Biology, Emory University, Atlanta, Georgia, United States of America
| | - Kun-Yong Kim
- Department of Genetics, Yale Stem Cell Center, Yale School of Medicine, New Haven, Connecticut, United States of America
| | - L. Alex Ambrose
- Department of Biology, Agnes Scott College, Decatur, Georgia, United States of America
| | - Christopher Chapleau
- Department of Neurobiology, The University of Alabama, Birmingham, Alabama, United States of America
| | - Gaston Calfa
- Department of Neurobiology, The University of Alabama, Birmingham, Alabama, United States of America
| | - Christina Gross
- Cell Biology, Emory University, Atlanta, Georgia, United States of America
| | - Gary J. Bassell
- Cell Biology, Emory University, Atlanta, Georgia, United States of America
| | - Lucas Pozzo-Miller
- Department of Neurobiology, The University of Alabama, Birmingham, Alabama, United States of America
| | - Yoland Smith
- Department of Neurology, Emory University, Atlanta, Georgia, United States of America
- Yerkes National Primate Center, Emory University, Atlanta, Georgia, United States of America
| | - Konrad Talbot
- Center for Neurobiology and Behavior, Department of Psychiatry, University of Pennsylvania, Philadelphia, Pennsylvania, United States of America
| | - In-Hyun Park
- Department of Genetics, Yale Stem Cell Center, Yale School of Medicine, New Haven, Connecticut, United States of America
| | - Victor Faundez
- Cell Biology, Emory University, Atlanta, Georgia, United States of America
| |
Collapse
|
|
40
|
Abstract
Modest overexpression of an epigenetic regulatory protein in a developmental disorder alters T helper cell differentiation and causes immune defects.
Collapse
Affiliation(s)
- Mark Boothby
- Department of Pathology, Microbiology, and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232-2363, USA.
| | | |
Collapse
|
|
41
|
Schaefer GB, Mendelsohn NJ. Clinical genetics evaluation in identifying the etiology of autism spectrum disorders: 2013 guideline revisions. Genet Med 2013; 15:399-407. [PMID: 23519317 DOI: 10.1038/gim.2013.32] [Citation(s) in RCA: 345] [Impact Index Per Article: 28.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/18/2022] Open
Abstract
The autism spectrum disorders are a collective of conditions that have in common impaired socialization and communication in association with stereotypic behaviors. The reported incidence of autism spectrum disorders has increased dramatically over the past two decades. In addition, increased attention has been paid to these conditions by both lay and professional groups. These trends have resulted in an increase in the number of referrals to clinical geneticist for the evaluation of persons with autism spectrum disorders. The primary roles of the geneticist in this process are to define etiology when possible, to provide genetic counseling, and to contribute to case management. In deciding on the appropriate evaluation for a particular patient, the geneticist will consider a host of factors: (i) ensuring an accurate diagnosis of autism before proceeding with any investigation; (ii) discussing testing options, diagnostic yields, and family investment before proceeding with an evaluation; (iii) communicating and coordinating with the patient-centered medical home (PCMH); (iv) assessing the continuously expanding and evolving list of available laboratory-testing modalities in light of the published literature; (v) recognizing the expanded phenotypes of well-described syndromic and metabolic conditions that overlap with autism spectrum disorders; and (vi) defining an individualized evaluation plan based on the unique history and clinical features of a given patient. The guidelines in this paper have been developed to assist the clinician in the consideration of these factors. It updates the original publication from 2008.Genet Med 2013:15(5):399-407.
Collapse
Affiliation(s)
- G Bradley Schaefer
- Department of Genetics and Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR, USA.
| | | | | |
Collapse
|
|
42
|
Delépine C, Nectoux J, Bahi-Buisson N, Chelly J, Bienvenu T. MeCP2 deficiency is associated with impaired microtubule stability. FEBS Lett 2012; 587:245-53. [PMID: 23238081 DOI: 10.1016/j.febslet.2012.11.033] [Citation(s) in RCA: 22] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/10/2012] [Revised: 10/05/2012] [Accepted: 11/28/2012] [Indexed: 01/25/2023]
Abstract
Rett syndrome (RTT) is a neurodevelopmental disorder caused by MECP2 mutations. Previous studies performed on Mecp2-deficient brain showed striking changes in neuronal maturation. We recently showed that MeCP2 deficiency affects microtubule (MT) dynamics in RTT astrocytes. Here, we analyze MT stability in primary fibroblast cultures from patients with RTT syndrome and identify a significant decrease in stability compared to controls. Furthermore, we found that MT stability was reduced both in cells expressing the mutant or the wild-type allele in RTT fibroblasts, suggesting that mutated cells could damage wild-type ones through a non-cell-autonomous pathway. These results suggest that MeCP2 has a stabilizing role on MT dynamics and that its deficiency could lead to impaired MT stability that may explain in part the dendritic abnormalities observed in RTT brains.
Collapse
Affiliation(s)
- Chloé Delépine
- Université Paris Descartes, CNRS UMR 8104, Institut Cochin, Laboratoire de Génétique des Maladies Neurodéveloppementales, Paris, France
| | | | | | | | | |
Collapse
|
|
43
|
Farra N, Zhang WB, Pasceri P, Eubanks JH, Salter MW, Ellis J. Rett syndrome induced pluripotent stem cell-derived neurons reveal novel neurophysiological alterations. Mol Psychiatry 2012; 17:1261-71. [PMID: 22230884 PMCID: PMC3504383 DOI: 10.1038/mp.2011.180] [Citation(s) in RCA: 88] [Impact Index Per Article: 6.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 12/11/2022]
Abstract
Rett syndrome (RTT) is a neurodevelopmental autism spectrum disorder caused by mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Here, we describe the first characterization and neuronal differentiation of induced pluripotent stem (iPS) cells derived from Mecp2-deficient mice. Fully reprogrammed wild-type (WT) and heterozygous female iPS cells express endogenous pluripotency markers, reactivate the X-chromosome and differentiate into the three germ layers. We directed iPS cells to produce glutamatergic neurons, which generated action potentials and formed functional excitatory synapses. iPS cell-derived neurons from heterozygous Mecp2(308) mice showed defects in the generation of evoked action potentials and glutamatergic synaptic transmission, as previously reported in brain slices. Further, we examined electrophysiology features not yet studied with the RTT iPS cell system and discovered that MeCP2-deficient neurons fired fewer action potentials, and displayed decreased action potential amplitude, diminished peak inward currents and higher input resistance relative to WT iPS-derived neurons. Deficiencies in action potential firing and inward currents suggest that disturbed Na(+) channel function may contribute to the dysfunctional RTT neuronal network. These phenotypes were additionally confirmed in neurons derived from independent WT and hemizygous mutant iPS cell lines, indicating that these reproducible deficits are attributable to MeCP2 deficiency. Taken together, these results demonstrate that neuronally differentiated MeCP2-deficient iPS cells recapitulate deficits observed previously in primary neurons, and these identified phenotypes further illustrate the requirement of MeCP2 in neuronal development and/or in the maintenance of normal function. By validating the use of iPS cells to delineate mechanisms underlying RTT pathogenesis, we identify deficiencies that can be targeted for in vitro translational screens.
Collapse
Affiliation(s)
- N Farra
- Program in Developmental and Stem Cell Biology, Hospital for Sick Children, Toronto, ON, Canada
| | | | | | | | | | | |
Collapse
|
|
44
|
Zachariah RM, Olson CO, Ezeonwuka C, Rastegar M. Novel MeCP2 isoform-specific antibody reveals the endogenous MeCP2E1 expression in murine brain, primary neurons and astrocytes. PLoS One 2012. [PMID: 23185431 PMCID: PMC3501454 DOI: 10.1371/journal.pone.0049763] [Citation(s) in RCA: 54] [Impact Index Per Article: 4.2] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/22/2022] Open
Abstract
Rett Syndrome (RTT) is a severe neurological disorder in young females, and is caused by mutations in the X-linked MECP2 gene. MECP2/Mecp2 gene encodes for two protein isoforms; MeCP2E1 and MeCP2E2 that are identical except for the N-terminus region of the protein. In brain, MECP2E1 transcripts are 10X higher, and MeCP2E1 is suggested to be the relevant isoform for RTT. However, due to the unavailability of MeCP2 isoform-specific antibodies, the endogenous expression pattern of MeCP2E1 is unknown. To gain insight into the expression of MeCP2E1 in brain, we have developed an anti-MeCP2E1 antibody and validated its specificity in cells exogenously expressing individual MeCP2 isoforms. This antibody does not show any cross-reactivity with MeCP2E2 and detects endogenous MeCP2E1 in mice brain, with no signal in Mecp2tm1.1Bird y/− null mice. Additionally, we show the endogenous MeCP2E1 expression throughout different brain regions in adult mice, and demonstrate its highest expression in the brain cortex. Our results also indicate that MeCP2E1 is highly expressed in primary neurons, as compared to primary astrocytes. This is the first report of the endogenous MeCP2E1 expression at the protein levels, providing novel avenues for understanding different aspects of MeCP2 function.
Collapse
Affiliation(s)
- Robby M. Zachariah
- Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
| | - Carl O. Olson
- Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
| | - Chinelo Ezeonwuka
- Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
| | - Mojgan Rastegar
- Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
- * E-mail:
| |
Collapse
|
|
45
|
Samaco RC, McGraw CM, Ward CS, Sun Y, Neul JL, Zoghbi HY. Female Mecp2(+/-) mice display robust behavioral deficits on two different genetic backgrounds providing a framework for pre-clinical studies. Hum Mol Genet 2012; 22:96-109. [PMID: 23026749 DOI: 10.1093/hmg/dds406] [Citation(s) in RCA: 141] [Impact Index Per Article: 10.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/21/2023] Open
Abstract
Rett syndrome (RTT) is an X-linked neurological disorder caused by mutations in the gene encoding the transcriptional modulator methyl-CpG-binding protein 2 (MeCP2). Typical RTT primarily affects girls and is characterized by a brief period of apparently normal development followed by the loss of purposeful hand skills and language, the onset of anxiety, hand stereotypies, autistic features, seizures and autonomic dysfunction. Mecp2 mouse models have extensively been studied to demonstrate the functional link between MeCP2 dysfunction and RTT pathogenesis. However, the majority of studies have focused primarily on the molecular and behavioral consequences of the complete absence of MeCP2 in male mice. Studies of female Mecp2(+/-) mice have been limited because of potential phenotypic variability due to X chromosome inactivation effects. To determine whether reproducible and reliable phenotypes can be detected Mecp2(+/-) mice, we analyzed Mecp2(+/-) mice of two different F1 hybrid isogenic backgrounds and at young and old ages using several neurobehavioral and physiological assays. Here, we report a multitude of phenotypes in female Mecp2(+/-) mice, some presenting as early as 5 weeks of life. We demonstrate that Mecp2(+/-) mice recapitulate several aspects of typical RTT and show that mosaic expression of MeCP2 does not preclude the use of female mice in behavioral and molecular studies. Importantly, we uncover several behavioral abnormalities that are present in two genetic backgrounds and report on phenotypes that are unique to one background. These findings provide a framework for pre-clinical studies aimed at improving the constellation of phenotypes in a mouse model of RTT.
Collapse
Affiliation(s)
- Rodney C Samaco
- Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, TX 77030, USA
| | | | | | | | | | | |
Collapse
|
|
46
|
Coghlan S, Horder J, Inkster B, Mendez MA, Murphy DG, Nutt DJ. GABA system dysfunction in autism and related disorders: from synapse to symptoms. Neurosci Biobehav Rev 2012; 36:2044-55. [PMID: 22841562 DOI: 10.1016/j.neubiorev.2012.07.005] [Citation(s) in RCA: 323] [Impact Index Per Article: 24.8] [Reference Citation Analysis] [Abstract] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/26/2012] [Revised: 07/10/2012] [Accepted: 07/16/2012] [Indexed: 12/13/2022]
Abstract
Autism spectrum disorders (ASDs) are neurodevelopmental syndromes characterised by repetitive behaviours and restricted interests, impairments in social behaviour and relations, and in language and communication. These symptoms are also observed in a number of developmental disorders of known origin, including Fragile X Syndrome, Rett Syndrome, and Foetal Anticonvulsant Syndrome. While these conditions have diverse etiologies, and poorly understood pathologies, emerging evidence suggests that they may all be linked to dysfunction in particular aspects of GABAergic inhibitory signalling in the brain. We review evidence from genetics, molecular neurobiology and systems neuroscience relating to the role of GABA in these conditions. We conclude by discussing how these deficits may relate to the specific symptoms observed.
Collapse
Affiliation(s)
- Suzanne Coghlan
- King's College London, Department of Forensic and Neurodevelopmental Sciences, Institute of Psychiatry, De Crespigny Park, London, SE5 8AF, United Kingdom
| | | | | | | | | | | |
Collapse
|
|
47
|
Abstract
Rett syndrome is an X-linked autism-spectrum disorder caused by mutations in MECP2, encoding methyl CpG-binding protein 2. Since the discovery of MECP2 mutations as the genetic cause of Rett syndrome, the understanding of MeCP2 function has evolved. Although MeCP2 was predicted to be a global transcriptional repressor of methylated promoters, large-scale combined epigenomic approaches of MeCP2 binding, methylation and gene expression have demonstrated that MeCP2 binds preferentially to intergenic and intronic regions, and sparsely methylated promoters of active genes. This review compares the evolution of thought within two ‘classic’ epigenetic mechanisms of parental imprinting and X chromosome inactivation to that of the MeCP2 field, and considers the future relevance of integrated epigenomic databases to understanding autism and Rett syndrome.
Collapse
Affiliation(s)
- Janine M LaSalle
- Medical Microbiology and Immunology and Rowe Program in Human Genetics, University of California Davis School of Medicine, Davis, CA 95616, USA.
| | | |
Collapse
|
|
48
|
Corbani S, Chouery E, Fayyad J, Fawaz A, El Tourjuman O, Badens C, Lacoste C, Delague V, Megarbane A. Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation. JOURNAL OF INTELLECTUAL DISABILITY RESEARCH : JIDR 2012; 56:415-420. [PMID: 21954873 DOI: 10.1111/j.1365-2788.2011.01479.x] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 05/31/2023]
Abstract
BACKGROUND Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.
Collapse
Affiliation(s)
- S Corbani
- Unité de Génétique Médicale et laboratoire associé INSERM à l'Unité UMR_S910, Université Saint-Joseph, Beirut, Lebanon
| | | | | | | | | | | | | | | | | |
Collapse
|
|
49
|
Abstract
Mutations in MECP2 (methyl-CpG-binding protein 2) are linked to the severe postnatal neurodevelopmental disorder RTT (Rett syndrome). MeCP2 was originally characterized as a transcriptional repressor that preferentially bound methylated DNA; however, recent results indicate MeCP2 is a multifunctional protein. MeCP2 binding is now associated with certain expressed genes and involved in nuclear organization as well, indicating that its gene regulatory function is context-dependent. In addition, MeCP2 is proposed to regulate mRNA splicing and a mouse model for RTT shows aberrant mRNA splicing. To further understand MeCP2 and potential roles in RTT pathogenesis, we have employed a biochemical approach to identify the MeCP2 protein complexes present in the mammalian brain. We show that MeCP2 exists in at least four biochemically distinct pools in the brain and characterize one novel brain-derived MeCP2 complex that contains the splicing factor Prpf3 (pre-mRNA processing factor 3). MeCP2 directly interacts with Prpf3 in vitro and in vivo and many MECP2 RTT truncations disrupt the MeCP2-Prpf3 complex. In addition, MeCP2 and Prpf3 associate in vivo with mRNAs from genes known to be expressed when their promoters are associated with MeCP2. These results support a role for MeCP2 in mRNA biogenesis and suggest an additional mechanism for RTT pathophysiology.
Collapse
|
|
50
|
Sanmann JN, Schaefer GB, Buehler BA, Sanger WG. Algorithmic approach for methyl-CpG binding protein 2 (MECP2) gene testing in patients with neurodevelopmental disabilities. J Child Neurol 2012; 27:346-54. [PMID: 22123427 DOI: 10.1177/0883073811424796] [Citation(s) in RCA: 6] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 01/06/2023]
Abstract
Methyl-CpG binding protein 2 gene (MECP2) testing is indicated for patients with numerous clinical presentations, including Rett syndrome (classic and atypical), unexplained neonatal encephalopathy, Angelman syndrome, nonspecific mental retardation, autism (females), and an X-linked family history of developmental delay. Because of this complexity, a gender-specific approach for comprehensive MECP2 gene testing is described. Briefly, sequencing of exons 1 to 4 of MECP2 is recommended for patients with a Rett syndrome phenotype, unexplained neonatal encephalopathy, an Angelman syndrome phenotype (with negative 15q11-13 analysis), nonspecific mental retardation, or autism (females). Additional testing for large-scale MECP2 deletions is recommended for patients with Rett syndrome or Angelman syndrome phenotypes (with negative 15q11-13 analysis) following negative sequencing. Alternatively, testing for large-scale MECP2 duplications is recommended for males presenting with mental retardation, an X-linked family history of developmental delay, and a significant proportion of previously described clinical features (particularly a history of recurrent respiratory infections).
Collapse
Affiliation(s)
- Jennifer N Sanmann
- Human Genetics Laboratories, University of Nebraska Medical Center and the Munroe-Meyer Institute for Genetics and Rehabilitation, Omaha, NE 68198-5440, USA.
| | | | | | | |
Collapse
|