Copyright
©The Author(s) 2003.
World J Gastroenterol. Dec 15, 2003; 9(12): 2662-2665
Published online Dec 15, 2003. doi: 10.3748/wjg.v9.i12.2662
Published online Dec 15, 2003. doi: 10.3748/wjg.v9.i12.2662
Table 1 Primer sequences used in PCR reactions (shown in the 5’ to 3’ direction)
Primer name | Forward sequence | Reverse sequence | Size (bp) | Annealing temp. (°C) | |
P53 | Exon2+3 | ccaggtgacccagggttg | gcaagggggactgtagatgg | 402 | 62 |
Exon4 | acctggtcctctgactgctc | gccaggcattgaagtctcat | 363 | 60 | |
Exon5+6 | ccgtgttccagttgctttat | ttaacccctcctcccaga | 488 | 58 | |
Exon7 | tgcttgccacaggtctcc | ccggaaatgtgatgagaggt | 301 | 60 | |
Exon8+9 | ttccttactgcctcttgctt | agaaaacggcattttgagtg | 411 | 57 | |
Exon10 | ctcaggtactgtgtatatac | ctatggctttccaacctagga | 218 | 55 | |
Exon11 | tcatctctcctccctgcttc | ccacaacaaaacaccagtgc | 300 | 60 | |
ST7 | Exon3 | gtagtgtcactgaacttacgc | gctctctgaaccagaccca | 154 | 55 |
Exon4 | aggtcttgcttttctctctca | caaaaagccctcccattcag | 213 | 55 | |
Exon5 | tgtcctctactgagtctacc | gtatcctatcaatggcaactg | 223 | 55 | |
Exon12 | gtgtagatgcttccgggttg | taacgagttcctgtggggat | 187 | 55 |
Table 2 p53 mutations in sporadic gastric carcinomas
Specimen No. | Pathology | Exon | Codon | Mutation | Effect | DHPLC (temp) | DHPLC gradient (B% in 4.5 min) |
H3 | Poorly diff. | 6 | 188 | CTG > CCG | Leu188Pro | 63 | 60-66 |
54 | Tubular | 7 | 246 | Del 24bpa | 8 amino acid deletion | 57,59,61 | 54-63 |
57 | Tubular | 6 | 215 | AGT > GGT | Ser215Gly | 62 | 57-66 |
64 | Tubular | 5 | 167 | Ins 3bpa | Gln insertion | 60 | 57-66 |
77 | Tubular | 7 | 235 | Del 1bp(C)a | Framshift (246stop) | 61 | 53-62 |
79 | Papillary | 8 | 301 | CCA > CTA | Pro301Leu | 60 | 54-63 |
86 | Poorly diff. | 5 | 161 | GCC > GGC | Ala161Gly | 61 | 53-62 |
133 | Papillary | 5 | 135 | TGC > TGG | Cys135Trp | 62 | 57-66 |
36 | Intron 7 | C > T, T > G | 57 | 54-63 |
- Citation: Lu C, Xu HM, Ren Q, Ao Y, Wang ZN, Ao X, Jiang L, Luo Y, Zhang X. Somatic mutation analysis of p53 and ST7 tumor suppressor genes in gastric carcinoma by DHPLC. World J Gastroenterol 2003; 9(12): 2662-2665
- URL: https://www.wjgnet.com/1007-9327/full/v9/i12/2662.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i12.2662