Copyright
©The Author(s) 2002.
World J Gastroenterol. Aug 15, 2002; 8(4): 699-702
Published online Aug 15, 2002. doi: 10.3748/wjg.v8.i4.699
Published online Aug 15, 2002. doi: 10.3748/wjg.v8.i4.699
Table 1 Nucleotide sequences and positions of primers
Primers | Sequence (5’-3’) | Position | band sizes (bp) |
CE (+) | ATTGGATTGGCCATCCGGTG | 620-639 | |
P (-)1 | TCCACCACCACCCTCTCGACTC | 1169-1190 | 571 |
P (-)2 | GCATTACACTGTACGTGCAC | 1271-1290 | 671 |
C (-)1 | CACCAACACCCATACCTGCA | 1470-1489 | 870 |
C (-)2 | GCGCACATTGGCGCAATTGTG | 1683-1703 | 1084 |
E (-)1 | CGCACCCCATCTCAGCTTCA | 1330-1349 | 730 |
E (-)2 | TTCATTGTCGGCAAACCTTGA | 1727-1747 | 1128 |
H (-) | CCAATCTTCCTGATCCAAAGC | 1557-1577 | |
H (+)1 | AACCCTACACCTTTCCAACA | 1146-1165 | 432 |
H (+)2 | GATTCATTCTGCAGATTGGC | 989-1008 | 589 |
Table 2 Sensitivity of semi-nested-PCR for different viruses
Viruses | Virus concentration (PFU) | ||||
103 | 102 | 101 | 100 | 10-1 | |
Poliovirus | + | + | + | + (2.4) | - |
Coxsackie virus B3 | + | + | + | + (2.1) | - |
Echovirus 9 | + | + | + | + (6.0) | - |
Three viruses | + | + | + (10.5) | - | - |
- Citation: Li JW, Wang XW, Yuan CQ, Zheng JL, Jin M, Song N, Shi XQ, Chao FH. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR. World J Gastroenterol 2002; 8(4): 699-702
- URL: https://www.wjgnet.com/1007-9327/full/v8/i4/699.htm
- DOI: https://dx.doi.org/10.3748/wjg.v8.i4.699