Polymorphism of p16INK4a gene and rare mutation of p15INK4b gene exon2 in primary hepatocarcinoma

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 6, Issue 3

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

All Articles published online

Item

Count

PDF

206

HTML

1541

Figures (1-5)

172

Tables (1-1)

162

Sum=2081

Jun 15, 2000 (publication date) through Nov 20, 2024

Times Cited of This Article

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Brief Reports

World J Gastroenterol. Jun 15, 2000; 6(3): 411-414
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.411

Table 1 Primers for p16INK4a and p15INK4b genes analysis

Gene	Primers	Fragment length (bp)	Ref
p16INK4a exon 1	5'GGGAGCAGCATGGAGCCCG3' (sense)	204	[6]
p16INK4a exon 1	5'AGTCGCCCGCCATCCCCT3' (antisense)
p16INK4a intron 1 and exon 2	5'GGAAATTGGAAACTGGAAGC3' (sense)	168	[1]
p16INK4a intron 1 and exon 2	5'GCTGCCCATCATCATGACCT3' (antisense)
p16INK4a exon 2 and exon 3	5'GGCAGGTCATGATGATGGGC3' (sense)	362	[1]
p16INK4a exon 2 and exon 3	5'TCTGAGCTTTGGAAGCTCT3' (antisense)
p15INK4b exon 2	5'GGCCGGCATCTCCCATACCTG3' (sense)	345	[9]
p15INK4b exon 2	5'TGTGGGCGGCTGGGAACCTG3' (antisense)

Citation: Qin Y, Li B, Tan YS, Sun ZL, Zuo FQ, Sun ZF. Polymorphism of p16INK4a gene and rare mutation of p15INK4b gene exon2 in primary hepatocarcinoma. World J Gastroenterol 2000; 6(3): 411-414
URL: https://www.wjgnet.com/1007-9327/full/v6/i3/411.htm
DOI: https://dx.doi.org/10.3748/wjg.v6.i3.411