Identification of functional tumor necrosis factor-alpha promoter variants associated with Helicobacter pylori infection in the Sudanese population: Computational approach

doi:10.3748/wjg.v28.i2.242

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 28, Issue 2

This Article

Academic Content and Language Evaluation of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (8123)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-6) series, Tables (1-10) series.

Item

Count

PDF

313

WORD

113

HTML

3694

Figures (1-6)

762

Tables (1-10)

574

Sum=5456

Featured Article

The chart showing Browse series, Download series.

Item

Count

Browse

261

Download

766

Sum=1027

Publishing Process of This Article

Item

Count

Browse

387

Download

1253

Sum=1640

Jan 14, 2022 (publication date) through Jan 9, 2025

Times Cited of This Article

Times Cited (1)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Observational Study

World J Gastroenterol. Jan 14, 2022; 28(2): 242-262
Published online Jan 14, 2022. doi: 10.3748/wjg.v28.i2.242

Table 1 Demographic characteristics of the study population, n (%)

Variable		*Helicobacter pylori* (+ve)	*Helicobacter pylori* (-ve)	Total	P value
Variable		n = 61	n = 61	n = 122	P value
Mean age in yr ± Standard deviation (range)		44.00 ± 16.99 (15-85)	44.74 ± 18.10 (17-89)	44.37 ± 17.48 (15-89)	0.9184¹
Gender	Male	36 (50.00)	36 (50.00)	72 (59.02)	1.0000
Gender	Female	25 (50.00)	25 (50.00)	50 (40.98)	1.0000
Residence	Urban	24 (44.44)	30 (55.56)	54 (44.26)	0.3622
Residence	Rural	37 (54.41)	31 (45.59)	68 (55.74)	0.3622
Hospital	Public	21 (33.87)	31 (49.21)	52 (41.60)	0.0667
Hospital	Private	41 (58.57)	29 (41.43)	70 (57.38)	0.0667

¹Mann-Whitney U, Gaussian Approximation. +ve: Positive; -ve: Negative.

Table 2 Gastric pathologies of the study population, n (%)

Endoscopy results	n (%)	*Helicobacter pylori* (+ve)	*Helicobacter pylori* (-ve)	P value¹
Normal gastric findings	9 (7.40)	4 (6.45)	5 (7.94)	0.2686
Esophagitis	4 (3.30)	3 (4.80)	1 (1.59)
Esophageal varices	6 (4.90)	1 (1.61)	5 (7.94)
Gastritis	55 (45.10)	28 (45.16)	27 (42.86)
Duodenitis	6 (4.90)	3 (4.84)	3 (4.76)
Peptic ulcer	27 (22.13)	17 (27.42)	10 (15.87)
Cancer	15 (12.30)	5 (8.20)	10 (16.4)
Total	122 (100)	61 (50.00)	61 (50.00)

¹χ² test, df: 7.603, 6. +ve: Positive; -ve: Negative.

Table 3 Nucleotide variations in the 5’-regulatory (-584 to +107) region of tumor necrosis alpha in Sudanese Helicobacter pylori-infected patients

SNP	Event	SNP locus¹	Chromosomeposition	Serialnumber (rs)
C>G (homozygous)	Transversion	-567	NG_007462.1:g.4422 C>G	rs2857711
G>A (heterozygous)	Transition	-375	NG_007462.1:g.4614 G>A	rs1800750
G>A (heterozygous and homozygous)	Transition	-307	NG_007462.1:g.4682 G>A	rs1800629
G>A (heterozygous)	Transition	-237	NG_007462.1:g.4752 G>A	rs361525
T>A (heterozygous)	Transversion	-76	NG_007462.1:g.4913 T>A	rs41297589
A>T (heterozygous)	Transversion	+27	NG_007462.1:g.5016 A>T²	-
Insertion of C	-	+70	NG_007462.1:g.5058-5059 InsC	-

¹Position of the single nucleotide polymorphism is relative to the tumor necrosis factor-alpha mRNA cap site[26].

²Novel mutation at the 5’ untranslated region detected in this study. SNP: Single nucleotide polymorphism.

Table 4 Overview of the in silico predicted tumor necrosis factor-alpha promoter regions for the respective prediction programs. The most predicted region is indicated in bold

Prediction program	Predicted promoter regions¹
BDGP (NNPP version 2.2)²	-40 to +10
Promoter 2.0 Prediction Server	no promoter
FPROM	+5
TSSG³	-146
TSSW⁴	-140
TSSW⁴	+6

¹All positions are relative to the tumor necrosis factor-alpha mRNA cap site[26].

²NNPP: Neural network promoter prediction; Threshold 0.80.

³Threshold for LDF- 4.00.

⁴Thresholds for TATA+ promoters - 0.45, for TATA−/enhancers - 3.70.

Table 5 Summary of the in silico predicted transcription factor binding sites for tumor necrosis factor-alpha (-146 to +10) region

TranscriptionFactor	Position¹		SNP in binding site	Software
TranscriptionFactor	Start	End	SNP in binding site	AliBaba2.1	Alggen Promo		Tfsitescan	TF-Binding		GPMiner
Elk-1	-145	-130				X²			X
Sp1	-138	-126		X			X
AP-2	-129	-118				X			X
Ets-1	-118	-111					X
PEA3/ Ets-1	-118	-110					X
T3R_TRE1	-115	-108				X	X		X
TNF-alpha-CRE	-112	92					X		X
C/EBP-beta	-100	-74	rs41297589 [-76]³				X		X
NF-kappaB	-99	-86					X		X
AP-1	-67	-57					X
NF-kappaB	-55	-46	rs765073823 [-48]rs537401710 [-47]	X
Sp1	-54	-41	rs765073823 [-48]rs537401710 [-47]	X		X	X
Sp1	-48	-39	rs765073823 [-48]rs537401710 [-47]	X		X	X
GATA	-40	-30	rs539666421 [-38]	X		X			X
AP-2	-38	-27	rs539666421 [-38]	X			X		X
TBP	-29	-20		X					X	X

¹Position is relative to the tumor necrosis factor-alpha transcription start site.

²X means the transcription factor is predicted by the software that is marked with X.

³Observed in this study. SNP: Single nucleotide polymorphism.

Table 6 Overview of conserved transcription factor binding sites predicted by multiple-sequence local alignment and visualization

Transcription Factor	Binding sequence	Position¹		Conserved SNPs
Transcription Factor	Binding sequence	Start	End	Conserved SNPs
V$CETS168_Q6	gCTTCCTC	-115	-108
V$ETS_Q6	gcTTCCtc	-115	-108
V$SP1_Q4_01	ttccCCGCCCtcc	-51	-39	rs765073823 [-48]rs537401710 [-47]
V$SP1_Q6_01	tcCCCGCCCt	-50	-41	rs765073823 [-48]rs537401710 [-47]
V$SP1_Q2_01	cCCCGCCCtc	-49	-40	rs765073823 [-48]rs537401710 [-47]

¹All positions are relative to the tumor necrosis factor-alpha mRNA cap site. Multiple-sequence local alignment and visualization (https://mulan.dcode.org/) to be conserved (100%) between human, chimpanzee, rhesus monkey, cow, and domesticated dog at the (-146 to +10) region. The crucial transcription factor for tumor necrosis factor transcription, nuclear factor, was not included.

Table 7 Summary of the in silico predicted composite regulatory elements for the -146 to +10 region of tumor necrosis factor-alpha

Composite element	MatrixName for a 1^st element	Score, strand	Distance in between	MatrixName for a 2^nd element	Score, strand	Position of CE, orientation	orientation	Composite score	P value	Sequence
CE00266	V$ETS_Q6	0.991+	12	V$AP1_Q2_01	0.831+	-118	+	0	1.08e-03	GCTTCCTCCagaTGAGCTCATGGG
CE00109	V$AP1_C	0.853-	8	V$NFAT_Q6	0.943-	-66	-	0.007	3.42e-03	TTGAATGATTCTTTCCCCGC
CE00150	V$AP1_C	0.853-	8	V$NFAT_Q6	0.943-	-66	-	-0.237	3.42e-03	TTGAATGATTCTTTCCCCGC
CE00058	V$HMGIY_Q6	0.955-	-5	V$NFKB_Q6_01	0.759-	-78	-	-0.09	6.89e-03	GTTTTCCGCTG
CE00058	V$HMGIY_Q6	0.955-	-4	V$NFKB_Q6_01	0.662-	-78	-	0.005	9.20e-03	GTTTTCCGCTGG
CE00064	V$HNF3_Q6	0.780+	15	V$NF1_Q6	0.956+	-28	+	-0.254	4.83e-02	ACATATAAAGGCAGtTGTTGGCACACCCAGCCA

CE: Composite regulatory elements.

Table 8 Allele and genotype frequencies of tumor necrosis factor-alpha-1030 polymorphism among Helicobacter pylori-infected and uninfected subjects and their contributions to Helicobacter pylori infection, n (%)

		*H. pylori* (+ve), n = 61	*H. pylori* (-ve), n = 61	P value	OR (95%CI)
Allele frequency
	TNF-A-1030-T	88 (72.13)	98 (80.33)	0.176	0.63 (0.349-1.151)
	TNF-A-1030-C	34 (27.87)	24 (19.67)	0.176	0.63 (0.349-1.151)
Genotype frequency
	T/T	32 (52.46)	43 (70.49)	-	1 (reference)
	T/C	24 (39.34)	12 (19.67)	0.020^a	2.69 (1.17-6.17)
	C/C	5 (8.20)	6 (9.84)	0.862	1.12 (0.31-3.99)

^aP value < 0.05 statistically significant difference. OR: Odds ratio; 95%CI: 95% confidence interval; H. pylori: Helicobacter pylori; +ve: Positive; -ve: Negative; TNF-A: Tumor necrosis factor-alpha.

Table 9 Multivariate analysis of genotype frequencies of tumor necrosis factor-alpha-1030 polymorphism and sociodemographic characteristics in Helicobacter pylori infection

Variables		P value	OR (95%CI)
Age		0.946	0.99 (0.98-1.02)
Gender	Male		1 (reference)
Gender	Female	0.845	0.93 (0.42-2.02)
Residence	Urban		1 (reference)
Residence	Rural	0.341	1.46 (0.67-3.18)
Hospital	Private		1 (reference)
Hospital	Public	0.045¹	0.45 (0.21-0.98)
Genotype frequency	T/T		1 (reference)
	T/C	0.016^a	2.87 (1.22-6.78)
	C/C	0.982	1.02 (0.27-3.88)

¹Weak evidence of significant different.

^aP value < 0.05 statistically significant different. OR: Odds ratio; 95%CI: 95% confidence interval.

Table 10 Tumor necrosis factor-alpha-1030 polymorphism and gastric cancer association risk in gastric cancerous patients and subjects with benign gastric disorders, n (%)

	Gastric pathologies		OR (95%CI)
	Benign disorders¹*, n* = 108	Cancer, n = 14	OR (95%CI)
Allele frequency
TNF-A-1030-T	176 (90.28)	21 (75.00)	1.150 (0.4627 - 2.8600)
TNF-A-1030-C	51 (9.72)	7 (25.00)	1.150 (0.4627 - 2.8600)
P value	0.8116
Genotype frequency
T/T	68 (62.96)	7 (50.00)	1.700 (0.5556 - 5.2020)
C carrier	40 (37.04)	7 (50.00)	1.700 (0.5556 - 5.2020)
P value	0.3900

¹Benign disorders, i.e. gastritis, duodenitis or ulcer.

OR: Odds ratio; 95%CI: 95% confidence interval; TNF-A: Tumor necrosis factor-alpha.

Citation: Idris AB, Idris AB, Gumaa MA, Idris MB, Elgoraish A, Mansour M, Allam D, Arbab BM, Beirag N, Ibrahim EAM, Hassan MA. Identification of functional tumor necrosis factor-alpha promoter variants associated with Helicobacter pylori infection in the Sudanese population: Computational approach. World J Gastroenterol 2022; 28(2): 242-262
URL: https://www.wjgnet.com/1007-9327/full/v28/i2/242.htm
DOI: https://dx.doi.org/10.3748/wjg.v28.i2.242