Regulatory effect of a Chinese herbal medicine formula on non-alcoholic fatty liver disease

doi:10.3748/wjg.v25.i34.5105

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 25, Issue 34

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (15332)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-4) series, Tables (1-12) series.

Item

Count

PDF

925

WORD

266

HTML

11046

Figures (1-4)

471

Tables (1-12)

390

Sum=13098

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

769

Download

1465

Sum=2234

Sep 14, 2019 (publication date) through Mar 2, 2025

Times Cited of This Article

Times Cited (66)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

World J Gastroenterol. Sep 14, 2019; 25(34): 5105-5119
Published online Sep 14, 2019. doi: 10.3748/wjg.v25.i34.5105

Table 1 Primers used for RT-qPCR

Gene	Forward	Reverse
ZO-1	5’- CTGATGGTGTTCTGCCAAATTC – 3’	5' - GTCGCAAACCCACACTATCT - 3'
Occludin	5’- CCATCTGACTATGCGGAAAGAG – 3’	5' - TACCAGAGGCGGTGACTTAT - 3'
β-actin	5’ - ACCGTGAAAAGATGACCCAGAT – 3’	5' - CCAGAGGCATACAGGGACAA - 3'

ZO-1: Zonula occludens-1.

Table 2 Liver coefficient (mean ± SD)

Group	n	Liver weight (g)	Body weight (g)	Liver coefficient (%)
Control	8	11.56 ± 2.42	540.43 ± 90.11	2.13 ± 0.11
Model	8	15.35 ± 2.08	451.09 ± 43.89	3.41 ± 0.43^b
PH	8	10.81 ± 1.00	456.48 ± 42.41	2.37 ± 0.08^d
CHM	8	13.21 ± 2.18	437.81 ± 47.93	3.01 ± 0.21^b^d^f

^aP < 0.05,

^bP < 0.01 vs control group; ^cP < 0.05,

^dP < 0.01 vs model group; ^eP < 0.05,

^fP < 0.01 vs PH group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 3 Hepatocyte lipid droplet cavity area ratio (mean ± SD)

Group	n	Area ratio (%)
Control	5	0.00 ± 0.00
Model	5	72.15 ± 1.72
PH	5	31.01 ± 7.53^a
CHM	5	48.69 ± 5.85^a

^aP < 0.05 vs model group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 4 Effect of Chinese herbal medicine on blood lipid levels (mean ± SD, n = 8)

Group	TG (mmol/L)	TC (mmol/L)	LDL (mmol/L)	HDL (mmol/L)
Control	0.48 ± 0.20	1.67 ± 0.26	0.24 ± 0.08	0.95 ± 0.10
Model	0.83 ± 0.12^b	3.05 ± 0.67^b	1.38 ± 0.33^b	0.54 ± 0.05^b
PH	0.50 ± 0.08^d	1.69 ± 0.29^d	0.76 ± 0.28^b^d	0.61 ± 0.05^b^c
CHM	0.53 ± 0.12^d	2.04 ± 0.37^d	0.84 ± 0.16^b^d	0.72 ± 0.05^b^d^f

^bP < 0.01 vs control group;

^cP < 0.05,

^dP < 0.01 vs model group;

^fP < 0.01 vs PH group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine; TC: Total cholesterol; TG: Triglyceride; HDL: High density lipoprotein; LDL: Low density lipoprotein.

Table 5 Effect of Chinese herbal medicine on triglyceride levels in liver tissue (mean ± SD)

Group	n	TG (mmol/L)
Control	8	1.37 ± 0.67
Model	8	4.81 ± 0.72^b
PH	8	3.41 ± 0.43^b^d
CHM	8	3.41 ± 0.66^b^d

^bP < 0.01 v control group;

^dP < 0.01 vs model group. TG: Triglyceride; PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 6 Effect of Chinese herbal medicine on blood glucose levels (mean ± SD)

Group	n	Blood sugar (mmol/L)
Control	8	4.09 ± 0.26
Model	8	4.90 ± 0.33^b
PH	8	4.11 ± 0.20^d
CHM	8	4.28 ± 0.21^d

^bP < 0.01 vs control group;

^dP < 0.01 vs model group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 7 Effect of Chinese herbal medicine on serum liver function markers (mean ± SD)

Group	n	AST (U/L)	ALT (U/L)
Control	8	118.73 ± 13.71	39.91 ± 6.50
Model	8	238.13 ± 39.38^b	59.28 ± 9.69^b
PH	8	137.94 ± 5.83^d	48.84 ± 8.28^a^c
CHM	8	148.19 ± 20.59^a^d	49.36 ± 5.13^a^c

^aP < 0.05,

^bP < 0.01 vs control group;

^cP < 0.05,

^dP < 0.01 vs model group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase.

Table 8 Effect of Chinese herbal medicine on liver tissue TNF-α, TGF-β1, NF-kB, and TLR4 levels (mean ± SD)

Group	n	TNF-α (ng/mg)	TGF-β1 (ng/mg)	NF-kB (ng/mg)	TLR4 (ng/mg)
Control	8	5.35 ± 0.80	2.21 ± 0.43	10.87 ± 2.45	21.32 ± 1.87
Model	8	7.22 ± 0.81^b	3.01 ± 0.22^b	15.85 ± 2.50^b	30.28 ± 4.38^b
PH	8	5.48 ± 0.38^d	2.24 ± 0.26^d	12.15 ± 3.13^c	22.56 ± 3.02^d
CHM	8	6.01 ± 0.97^d	2.29 ± 0.40^d	12.57 ± 3.30	23.88 ± 3.21^d

^bP < 0.01 vs control group;

^cP < 0.05,

^dP < 0.01 vs model group. TGF-β1: Transforming growth factor-β1; TNF-α: Tumor necrosis factor-α; TLR4: Toll-like receptor-4; NF-kB: Nuclear factor-kappa B; PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 9 Intestinal sIgA levels (mean ± SD)

Group	n	sIgA (μg/mg)
Control	8	19.80 ± 2.25
Model	8	11.39 ± 1.81^b
PH	8	17.06 ± 2.92^a^d
CHM	8	12.78 ± 2.36^bf

^aP < 0.05,

^bP < 0.01 vs control group;

^dP < 0.01 vs model group; ^efP < 0.01 vs PH group. sIgA: Secreted immunoglobulin A; PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 10 Occludin and zonula occludens-1 protein levels (mean ± SD)

Group	n	Occludin	ZO-1
Control	7	1.12 ± 0.06	1.41 ± 0.03
Model	7	0.66 ± 0.07^b	0.82 ± 0.09^b
PH	7	1.04 ± 0.09^d	1.32 ± 0.04^d
CHM	7	0.68 ± 0.05^b^f	0.84 ± 0.12^b^f

^bP < 0.01 vs control group;

^dP < 0.01 vs model group;

^fP < 0.01 vs PH group. ZO-1: Zonula occludens-1; PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 11 Occludin and zonula occludens-1 mRNA expression levels (mean ± SD)

Group	n	Occludin mRNA	ZO-1 mRNA
Control	6	1.40 ± 0.19	1.31 ± 0.29
Model	6	0.60 ± 0.16^b	0.60 ± 0.11^b
PH	6	1.15 ± 0.24^a^d	1.15 ± 0.23^d
CHM	6	0.70 ± 0.13^b^f	0.79 ± 0.31^b^e

^aP < 0.05,

^bP < 0.01 vs control group;

^dP < 0.01 vs model group;

^eP < 0.05,

^fP < 0.01 vs PH group. ZO-1: Zonula occludens-1; PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Table 12 Levels of plasma endotoxin (mean ± SD)

Group	n	Endotoxin (%)
Control	8	0.028 ± 0.013
Model	8	0.160 ± 0.057^b
PH	8	0.045 ± 0.012^d
CHM	8	0.056 ± 0.018^d

^bP < 0.01 vs control group;

^dP < 0.01 vs model group. PH: Pioglitazone hydrochloride; CHM: Chinese herbal medicine.

Citation: Yang JM, Sun Y, Wang M, Zhang XL, Zhang SJ, Gao YS, Chen L, Wu MY, Zhou L, Zhou YM, Wang Y, Zheng FJ, Li YH. Regulatory effect of a Chinese herbal medicine formula on non-alcoholic fatty liver disease. World J Gastroenterol 2019; 25(34): 5105-5119
URL: https://www.wjgnet.com/1007-9327/full/v25/i34/5105.htm
DOI: https://dx.doi.org/10.3748/wjg.v25.i34.5105