Effects of sphincter of Oddi motility on the formation of cholesterol gallstones

Table 1 Primer sequences of CCKAR and GAPDH

Genes	Forward primer (5’-3’)	Reverse primer (5’-3’)
CCKAR	ACGGAGGGTAGTGAACTCCA	TCGCAGGCAGAAGTGATGTT
GAPDH	GCACCGTCAAGGCTGAGAAT	CATCACGAACATAGGGGCATC

CCKAR: Cholecystokinin-A receptor; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Table 2 Changes of sphincter of Oddi myoelectric activity in the process of gallstone formation

Group	Amplitude	Frequency
Control group	142.45 ± 71.25	16.56 ± 4.05
3-wk group	125.06 ± 59.76	13.70 ± 2.88
6-wk group	152.96 ± 81.05	15.10 ± 4.13
9-wk group	100.27 ± 50.42a	8.68 ± 2.35a
12-wk group	40.60 ± 15.03c	13.80 ± 3.79

^aP < 0.05,

^cP < 0.01 vs the control group.

Table 3 Sphincter of Oddi manometry in the process of gallstone formation

Group	SO basal pressure	CBD pressure	Amplitude of SO	Frequency of SO
Control group	26.59 ± 8.16	23.25 ± 8.35	8.72 ± 2.05	11.27 ± 3.74
3-wk group	21.25 ± 1.38	18.48 ± 1.94	8.33 ± 3.85	11.50 ± 1.64
6-wk group	27.57 ± 8.67	25.82 ± 8.26	8.03 ± 3.15	9.33 ± 3.27
9-wk group	34.11 ± 11.56	32.15 ± 11.64	5.89 ± 1.41a	7.67 ± 3.44a
12-wk group	52.38 ± 12.84c	50.11 ± 12.59e	6.82 ± 1.34	10.60 ± 3.51

^aP < 0.05,

^cP < 0.01,

^eP < 0.001 vs the control group. SO: Sphincter of Oddi; CBD: Common bile duct.

Table 4 Changes in VIP, gastrin and CCK-8 in the process of cholesterol stone formation (pg/mL)

Group	3-wk	6-wk	9-wk	12-wk
VIP
Control	9.36 ± 2.72	9.30 ± 8.91	6.91 ± 3.14	8.39 ± 0.99
Cholesterol stone	11.83 ± 3.57	7.08 ± 2.31	31.20 ± 7.78a	22.15 ± 2.87c
Gastrin
Control	17.83 ± 2.35	18.56 ± 5.77	17.42 ± 6.39	19.41 ± 4.58
Cholesterol stone	0.08 ± 0.03c	4.18 ± 2.87	2.16 ± 0.44a	18.92 ± 8.37
CCK-8
Control	1970.33 ± 439.82	2353.32 ± 13.18	2100.27 ± 29.70	2107.77 ± 171.70
Cholesterol stone	2214.61 ± 174.96	2044.18 ± 147.03	2034.75 ± 138.39	2042.61 ± 265.01

^aP < 0.05,

^cP < 0.01 vs the control group. VIP: Vasoactive intestinal peptide; CCK-8: Cholecystokinin octapeptide.