Copyright
©The Author(s) 2015.
World J Gastroenterol. Jul 21, 2015; 21(27): 8398-8407
Published online Jul 21, 2015. doi: 10.3748/wjg.v21.i27.8398
Published online Jul 21, 2015. doi: 10.3748/wjg.v21.i27.8398
Table 1 Risk level access of gastrointestinal stromal tumor
Risk level | Tumor size (cm) | Mitotic count (50/HPF) | Primary tumor location |
Very low | ≤ 2.0 | ≤ 5 | Any |
Low | 2.1-5.0 | ≤ 5 | Any |
Medium | 2.1-5.0 | > 5 | Stomach |
< 5.0 | 6-10 | Any | |
5.1-10.0 | ≤ 5 | Stomach | |
High | Any | Any | Tumor rupture |
> 10.0 | Any | Any | |
Any | > 10 | Any | |
> 5.0 | > 5 | Any | |
2.1-5.0 | > 5 | Non stomach | |
5.1-10.0 | ≤ 5 | Non stomach |
Table 2 Quantitative real-time PCR primer for candidate genes and endogenous reference gene
Gene name | Primer | Sequence (5'-3') | Tm (°C) | Amplicon size (bp) |
SLITRK3 | Forward | TTCCATAGCTGAGATGCTTCACA | 61.4 | 87 |
Reverse | GGAATCGGGGTAGTCCATCC | 61.2 | ||
18S | Forward | GTAACCCGTTGAACCCCATT | 60.4 | 151 |
Reverse | CCATCCAATCGGTAGTAGCG | 61.7 |
Table 3 Patient and tumor characteristics
Clinicopathological factors | n (%) | |
Gender | Male | 226 (54.2) |
Female | 191 (45.8) | |
Age (yr) | ≤ 60 | 223 (53.5) |
> 60 | 194 (46.5) | |
Median | 60 | |
Gastrointestinal bleeding | No | 315 (75.5) |
Yes | 102 (24.5) | |
Primary tumor site | Stomach | 229 (54.9) |
Small bowel | 123 (29.5) | |
Colon | 21 (5.0) | |
Others | 44 (10.6) | |
Predominant cell type | Spindle | 271 (65.0) |
Epithelioid | 54 (12.9) | |
Mixed | 92 (22.1) | |
Primary tumor size (cm) | 0-5 | 202 (48.4) |
5.1-10 | 138 (33.1) | |
> 10 | 77 (18.5) | |
Median | 5.5 | |
Mitotic index (per 50 HPFs) | 0-5 | 309 (74.1) |
6-10 | 60 (14.4) | |
> 10 | 48 (11.5) | |
NIH stage | Very low risk | 33 (7.9) |
Low risk | 154 (36.5) | |
Intermediate risk | 67 (16.1) | |
High risk | 163 (39.1) | |
Recurrence | No | 331 (79.4) |
Yes | 71 (17.0) | |
Insufficient data | 15 (3.6) | |
Death from illness | No | 376 (90.2) |
Yes | 26 (6.2) | |
Insufficient data | 15 (3.6) |
Table 4 Expression levels of SLITRK3 in gastrointestinal stromal tumor and adjacent non-tumor tissues n (%)
Tissue | SLITRK3 level | |||
- | + | ++ | +++ | |
Tumor | 14 (11) | 37 (28) | 49 (37) | 31 (24) |
Non-tumor tissue | 91 (69) | 33 (25) | 5 (4) | 2 (2) |
Table 5 Correlations between SLITRK3 expression and clinicopathological factors in 417 gastrointestinal stromal tumor patients
Clinicopathological factors1 | SLITRK3 expression | Number of patients | χ2 | P value2 | ||
Low | High | |||||
Gender | Male | 100 | 123 | 224 | 0.001 | 1.000 |
Female | 85 | 104 | 189 | |||
Age (yr) | ≤ 60 | 99 | 121 | 220 | 0.000 | 1.000 |
> 60 | 87 | 106 | 193 | |||
Gastrointestinal bleeding | No | 153 | 160 | 313 | 7.722 | 0.006 |
Yes | 33 | 67 | 100 | |||
Primary tumor site | Stomach | 120 | 106 | 226 | 24.730 | < 0.0013 |
Small bowel | 34 | 88 | 122 | |||
Colon | 14 | 7 | 21 | |||
Others | 18 | 26 | 44 | |||
Predominant cell type | Spindle | 126 | 144 | 270 | 2.552 | 0.279 |
Epithelioid | 26 | 27 | 53 | |||
Mixed | 34 | 56 | 90 | |||
Primary tumor size | ≤ 5 cm | 116 | 83 | 199 | 27.260 | < 0.0013 |
> 5 cm | 70 | 144 | 214 | |||
Mitotic index | ≤ 5/50 HPF | 157 | 149 | 306 | 18.763 | < 0.0013 |
> 5/50 HPF | 29 | 78 | 107 | |||
NIH stage | Very low risk | 28 | 3 | 31 | 53.340 | < 0.0013 |
Low risk | 87 | 67 | 154 | |||
Intermediate risk | 25 | 41 | 66 | |||
High risk | 46 | 116 | 162 |
Table 6 Univariate analysis of factors influencing overall survival in 402 patients with gastrointestinal stromal tumor
Factor | 5-yr OS rate (%) | OS HR (95%CI) | P value | |
Gender | Male: Female | 81.3: 89.2 | 0.508 (0.221-1.169) | 0.111 |
Age (yr) | ≤ 60: > 60 | 88.9: 80.0 | 2.186 (0.989-4.832) | 0.053 |
Gastrointestinal bleeding | No: Yes | 86.8: 81.2 | 1.259 (0.559-2.837) | 0.578 |
Primary tumor site | Gastric: Non-gastric | 83.0: 86.8 | 1.143 (0.529-2.470) | 0.733 |
Predominant cell type | Spindle: Epithelioid: Mixed | 87.7: 82.4: 88.8 | 0.935 (0.586-1.491) | 0.778 |
Primary tumor size (cm) | ≤ 5: > 5 | 99.2: 74.0 | 22.726 (3.079-167.742) | 0.0021 |
Mitotic index (HPFs) | ≤ 5/50: 6-10/50: > 10/50 | 96.5: 83.0: 39.7 | 4.727 (2.887-7.740) | < 0.0011 |
NIH stage | Very low: Low: Mid: High | 100.0: 100.0: 88.6: 70.3 | 8.005 (2.365-27.098) | 0.0011 |
SLITRK3 expression | (-): (+): (++): (+++) | 100.0: 99.0: 86.7: 57.4 | 4.164 (2.227-7.786) | < 0.0011 |
Table 7 Univariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor
Factor | 5-yr DFS rate (%) | DFS HR (95%CI) | P value | |
Gender | Male: Female | 69.0: 69.7 | 0.643 (0.398-1.038) | 0.071 |
Age (yr) | ≤ 60: > 60 | 72.1: 65.6 | 1.285 (0.806-2.049) | 0.292 |
Gastrointestinal bleeding | No: Yes | 71.6: 65.7 | 1.425 (0.874-2.322) | 0.155 |
Primary tumor site | Gastric: Non-gastric | 81.5: 59.4 | 2.669 (1.623-4.388) | 0.0011 |
Predominant cell type | Spindle: Epithelioid: Mixed | 72.0: 67.1: 71.3 | 0.877 (0.661-1.164) | 0.365 |
Primary tumor size (cm) | ≤ 5: > 5 | 92.2: 50.8 | 8.183 (3.921-17.079) | < 0.0011 |
Mitotic index (HPFs) | ≤ 5/50: 6-10/50: > 10/50 | 84.2: 50.7: 19.0 | 3.289 (2.545-4.253) | < 0.0011 |
NIH stage | Very low: Low: Mid: High | 100.0: 93.3: 87.1: 40.0 | 5.421 (3.249-9.045) | < 0.0011 |
SLITRK3 expression | (-): (+): (++): (+++) | 91.7: 78.6: 71.6: 41.8 | 2.082 (1.575-2.753) | < 0.0011 |
Table 8 Multivariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor
Factor | Model A | Model B | Model C | ||||
DFS HR(95%CI) | P value | DFS HR(95%CI) | P value | DFS HR(95%CI) | P value | ||
Primary tumor site | Gastric: Non-gastric | 1.762 (1.036-2.999) | 0.0371 | 2.046 (1.232-3.401) | 0.0062 | 1.593 (0.928-2.733) | 0.091 |
Primary tumor size (cm) | ≤ 5: > 5 | 1.388 (0.567-3.398) | 0.473 | 3.370 (1.545-7.351) | 0.0022 | 1.183 (0.477-2.934) | 0.717 |
Mitotic index (HPFs) | ≤ 5/50: 6-10/50: > 10/50 | 2.027 (1.494-2.749) | < 0.0012 | 2.549 (1.930-3.366) | < 0.0012 | 2.032 (1.496-2.760) | < 0.0012 |
NIH stage | Very low: Low: Mid: High | 2.753 (1.426-5.314) | 0.0032 | 2.707 (1.387-5.283) | 0.0042 | ||
SLITRK3 expression | (-): (+): (++): (+++) | 1.508 (1.151-1.976) | 0.0032 | 1.465 (1.114-1.928) | 0.0062 |
- Citation: Wang CJ, Zhang ZZ, Xu J, Wang M, Zhao WY, Tu L, Zhuang C, Liu Q, Shen YY, Cao H, Zhang ZG. SLITRK3 expression correlation to gastrointestinal stromal tumor risk rating and prognosis. World J Gastroenterol 2015; 21(27): 8398-8407
- URL: https://www.wjgnet.com/1007-9327/full/v21/i27/8398.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i27.8398