Comparative genomic study of gastric epithelial cells co-cultured with Helicobacter pylori

doi:10.3748/wjg.v18.i48.7212

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 18, Issue 48

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (5158)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-6) series, Tables (1-4) series.

Item

Count

PDF

485

HTML

4216

Figures (1-6)

200

Tables (1-4)

257

Sum=5158

Dec 28, 2012 (publication date) through Dec 29, 2024

Times Cited of This Article

Times Cited (12)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Original Article

World J Gastroenterol. Dec 28, 2012; 18(48): 7212-7224
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7212

Table 1 Primer pairs for quantitative real-time polymerase chain reaction

Gene	Primer Sequence (5’ to 3’)		Size of PCR product (bp)
	Sense	Anti-sense
HDAC6	ACCGCTACGAGCAGGGTA	CGAGACGTGCAGGAAAGC	155
TARF1	TCCCGTAACACCTGATTAA	ACAACTCCCAAACCATACAC	146
GAPDH	AACGGATTTGGTCGTATTGGG	TCGCTCCTGGAAGATGGTGAT	216

PCR: Polymerase chain reaction.

Table 2 Pathological outcomes of gastric mucosae from Mongolian gerbils lavaged with the most virulent gastric carcinoma-derived strain, the least virulent chronic gastritis-derived strain, and the control broth over 52 wk

	Pathological outcomes
	Chronic gastritis	Gastric atrophy	Intestinal metaplasia	Gastric dysplasia	Gastric carcinoma
GC (n = 10)	9 (90.0%)^b	8 (80.0%)^b^d	8 (80.0%)^b^d	9 (90.0%)^b^d	6 (60.0%)^b^d
CG (n = 10)	9 (90.0%)^b	0 (0.0%)	0 (0.0%)	0 (0.0%)	0 (0.0%)
Control (n = 10)	0 (0.0%)	0 (0.0%)	0 (0.0%)	0 (0.0%)	0 (0.0%)

^bP < 0.01 vs control group;

^dP < 0.01 vs CG group. GC: Gastric carcinoma; CG: Chronic gastritis.

Table 3 Differentially expressed genes with a fold change of > 2.0 or < 0.5 in GES-1 cells co-cultured with the most virulent gastric carcinoma-derived strain vs the least virulent chronic gastritis-derived strain

Gene name (n = 185)	Fold change GC/CG	Accession number
Cell cycle related genes
AMN1	4.748	BG031897
HDAC6	2.025	NM_006044
CCNE2	0.464	AF112857
KIF20B	0.462	NM_016195
DOCK8	0.456	AL161725
ASPM	0.452	AK001380
CENPF	0.450	U30872
NIPBL	0.432	NM_015384
SYCP2	0.424	NM_014258
ASPM	0.414	NM_018123
SGOL2	0.401	N31731
CENPE	0.398	NM_001813
CEP70	0.382	NM_024491
SGOL2	0.375	AW965339
DOCK11	0.363	AI742838
SERPINB3	0.290	BC005224
Apoptosis-related genes
TRAF1	2.254	NM_005658
TIA1	0.496	AL567227
OPA1	0.474	AB011139
PIK3CA	0.450	NM_006218
NUDT12	0.408	AL136592
PEG10	0.367	BE858180
Cytoskeleton and sports
ADD3	0.450	AI818488
KIAA0774	0.429	AI818409
KIF14	0.379	AW183154
KIF14	0.370	NM_014875
ADD3	0.344	BE545756
ADD3	0.316	NM_019903
Intracellular transport
VPS13A	0.435	AW629014
VPS13A	0.438	AW629014
IFT74	0.431	NM_025103
GOLGA4	0.425	NM_002078
ANKRD10	0.419	BE670056
IFT80	0.414	AB037795
FAM8A1	0.412	NM_016255
SNX2	0.406	NM_003100
ANKRD32	0.355	AL136560
DNA synthesis, repair, recombination
RAD50	0.472	NM_005732
SFPQ	0.457	AV705803
FAM8A1	0.412	NM_016255
LIN9	0.338	BF697734
DNA-binding ,transcription, transcription factor
ZNF253	5.254	NM_021047
KLF11	3.598	AA149594
SMARCA1	0.496	NM_003069
GOLGB1	0.492	NM_004487
KLF9	0.462	NM_001206
CHD1	0.459	NM_001270
PBX1	0.455	AL049381
TRIP11	0.434	AF007217
SMARCA1	0.433	NM_003069
C8orf83	0.433	BE962119
EPM2AIP1	0.430	BF432224
ELL2	0.420	AI745624
GLCCI1	0.400	AA058770
ARID5B	0.395	BG285011
ZNF644	0.390	NM_016620
BAZ2B	0.365	NM_013450
SAMD9	0.352	AA741307
SAMD9	0.345	NM_017654
TPR	0.346	BF110993
TPR	0.344	AK023111
LCORL	0.339	AI807408
TPR	0.300	AW235355
Cell signal and transduction
PRKCB	0.498	M13975
DST	0.493	NM_001723
FARP1	0.462	BF725250
GMFB	0.461	NM_004124
PPM1A	0.454	AA886888
IFT81	0.444	NM_014055
PDE10A	0.442	AI143879
ICK	0.428	NM_014920
ANKRD10	0.419	BE670056
IFT80	0.414	AB037795
SNX2	0.406	NM_003100
CNTLN	0.386	AA280904
MAP2K6	0.384	NM_002758
ANKRD32	0.355	AL136560
ARHGAP18	0.307	BE644830
Protein translation, synthesis, decomposition
RHOBTB3	0.500	NM_014899
ST13	0.490	U17714
EEF2K	0.488	W68180
TSHZ2	0.476	AW953679
TMF1	0.417	AI767750
HMMR	0.410	U29343
CCDC88A	0.387	AB033038
NSBP1	0.321	BC005342
Protein-coding gene
CXorf39	0.499	AI590719
LOC286052	0.478	AA278233
FLJ40113/LOC440295	0.411	AI632181
LOC100133781	0.374	AA973100
LOC100130360	0.346	BG231554
LOC643401	0.300	BC039509
Ion channel and transport
IFT74	0.496	AI610355
SLC5A3	0.493	AK024896
SLC2A13	0.489	AL565362
STEAP4	0.488	NM_024636
TMEM56	0.469	AI004375
EXOC5	0.466	BF509391
CACNB2	0.465	AI040163
SLC2A13	0.455	NM_052885
TMEM133	0.435	AF247167
DMXL2	0.405	AB020663
SNX13	0.401	R75838
SEC62	0.397	NM_153039
ATP11C	0.382	BF475862
TMEM106B	0.380	BF513060
PEG10	0.367	BE858180
SORBS2	0.222	AI659533
Cell proliferation, angiogenesis
ANGPTL4	2.460	NM_016109
TPR	0.492	NM_003292
TPR	0.492	NM_003292
PNN	0.487	U59479
PNN	0.428	U59479
ROCK2	0.404	AL049383
TTK	0.347	NM_003318
Immune-related genes
CFI	0.477	NM_000204
SERPINB4	0.431	AB046400
PIBF1	0.423	NM_006346
Metabolize-related genes
AK7	0.477	NM_152327
TTC3	0.471	AI652848
HS2ST1	0.438	NM_012262
MANEA	0.427	AI587307
PLA2G12A	0.416	AV714268
TTC3	0.413	D83077
PPP1CB	0.407	W67887
NUDT12	0.408	AL136592
TTC3	0.403	NM_003316
TTC3	0.403	AI885338
RNF150	0.398	AA722069
SEPP1	0.396	NM_005410
CRYZ	0.387	NM_001889
PDK4	0.374	AV707102
ABAT	0.359	AF237813
PLA2G12A	0.331	AI767751
AGXT2L1	0.326	NM_031279
CYP1B1t	0.314	NM_000104
METTL7A	0.274	NM_014033
Cell structure-related genes
ARMCX3	0.385	AL121883
ANK3	0.225	NM_020987
Cell Adhesion-related genes
KITLG	0.447	AI446414
PIK3CA	0.450	NM_006218
ANKRD10	0.419	BE670056
ANKRD32	0.355	AL136560
Stress-related genes
DNAJB4	0.400	BG252490
LXN	0.294	NM_020169
DNAJB4	0.471	NM_007034
Protein regulation
LOC727770	0.426	AI359676
TBC1D8B	0.368	AW172431
Cell differentiation
LIFR	0.374	AA701657
RNA processing
SR140	0.413	AU152088
Protein receptor
LANCL1	0.412	NM_006055
Oxidation
DIO2	0.434	AI038059
Cell growth-related genes
ITCH	0.441	AA868238
TGFBR3	0.450	AW193698
TGFBR3	0.422	NM_003243
Cytokine receptor
LTB	2.001	NM_002341

Table 4 Most differentially expressed genes in GES-1 cells co-cultured with the most virulent gastric carcinoma-derived strain vs the least virulent chronic gastritis-derived strain

Gene name	Betweenness centrality	Description	Identified or proposed function
JUN	0.201780	Jun oncogene	Cell growth and/or maintenance, signal transduction molecules, and transcription factors
KRAS	0.185944	v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	Regulation of cell cycle, cell growth and/or maintenance
BRCA1	0.162070	Breast cancer 1, early onset	DNA damage checkpoint; p53/ATM signaling, and induction of apoptosis
SMAD2	0.121460	SMAD family member 2	Transcription factors
TRAF1	0.092496	Tumor necrosis factor receptor-associated factor 1	DNA damage checkpoint, p53/NF-KB signaling, and cell cycle control
HDAC6	0.092239	Histone deacetylase 6	Cell proliferation and tumor angiogenesis

Citation: Wang F, Luo LD, Pan JH, Huang LH, Lv HW, Guo Q, Xu CX, Shen SR. Comparative genomic study of gastric epithelial cells co-cultured with Helicobacter pylori. World J Gastroenterol 2012; 18(48): 7212-7224
URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7212.htm
DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7212