Embryonic hepatocyte transplantation for hepatic cirrhosis: Efficacy and mechanism of action

Table 1 Primer sequences used for real-time polymerase chain reaction

Gene	Forward primer	Reverse primer	Segment length
STAP	AGTCCTCAGCTGCGGAAACA	AGCGCGAGCACAGAGGATAC	100 bp
α-SMA	CGGGCTTTGCTGGTGATG	GCTGTCCTTTTGGCCCATT	100 bp
C-myb	CCATCCAGAGACATTATAACGATGA	CTGTCCCTTCAGTTCGTTCTCTGT	100 bp
ET-1	GACCACAGACCAAGGGAACAG	TGGCATGGCCGAACTCAT	100 bp
β-actin	CATTGCTGACAGGATGCAGAAG	GAGCCACCAATCCACACAGAGT	100 bp

STAP: Stellate activation-associated protein; SMA: Smooth muscle actin; ET: Endothelin.

Table 2 Results of ultrasound examination (mean ± SD, n = 10)

	Diameter of the major trunk of the portal vein (mm)	Hepatic vein diameter (mm)	PVV (mm/s)	HVV (mm/s)
Normal control group	1.545 ± 0.095	0.775 ± 0.058	117.319 ± 15.306	122.00 ± 14.553
Untreated cirrhotic group	2.518 ± 0.138b	1.378 ± 0.128b	53.663 ± 9.730b	56.817 ± 17.855b
Transplantation group	1.565 ± 0.135d	0.804 ± 0.096d	104.535 ± 11.654ad	98.561 ± 15.955bd

^aP < 0.05,

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. PVV: Portal vein velocity; HVV: Hepatic vein velocity.

Table 3 Effects of hepatocyte transplantation on ultrasound measurement (mean ± SD, n = 8)

	Diameter of the major trunk of the portal vein (mm)	Hepatic vein diameter (mm)	PVV(mm/s)	HVV (mm/s)
Before hepatocyte transplantation	2.571 ± 0.343	1.361 ± 0.136	67.441 ± 6.666	54.679 ± 17.453
After hepatocyte transplantation	1.575 ± 0.146	0.790 ± 0.137	100.968 ± 9.796	94.423 ± 5.207

PVV: Portal vein velocity; HVV: Hepatic vein velocity.

Table 4 Effects of hepatocyte transplantation on serum biochemical tests (mean ± SD, n = 10)

	ALT (μmol/L)	AST (μmol/L)	TP (μmol/L)	ALB (μmol/L)	TBil (μmol/L)
Normal control group	22.297 ± 2.445	52.393 ± 32.356	61.984 ± 2.489	33.860 ± 1.102	2.015 ± 0.451
Untreated cirrhotic group	627.264 ± 113.580b	432.771 ± 100.330b	45.697 ± 2.646b	26.030 ± 1.282b	35.355 ± 9.587b
Transplantation group	86.623 ± 38.953ad	158.284 ± 94.099bd	56.174 ± 2.780bd	31.330 ± 1.222bd	1.957 ± 0.723d

^aP < 0.05,

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; TP: Total protein; ALB: Albumin; TBil: Total bilirubin.

Table 5 Effects of hepatocyte transplantation on serum mar-ker levels (mean ± SD, n = 10)

	PIII (μg/L)	ET-1 (pg/mL)	AFP (ng/mL)
Normal control group	48.096 ± 5.010	45.459 ± 12.626	12.150 ± 11.430
Untreated cirrhotic group	92.954 ± 4.481b	132.192 ± 8.906b	12.099 ± 8.529
Transplantation group	54.023 ± 4.535bd	42.383 ± 11.701d	61.315 ± 20.973bd

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. ET: Endothelin; AFP: α-fetoprotein.

Table 6 Average optical density values (mean ± SD, n = 10)

	α-SMA	ET-1
Normal control group	0.140 ± 0.023	0.161 ± 0.022
Untreated cirrhotic group	0.602 ± 0.060b	0.523 ± 0.063b
Transplantation group	0.150 ± 0.031d	0.172 ± 0.021d

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. SMA: Smooth muscle actin; ET: Endothelin.

Table 7 Optical density values of Western blotting protein bands (mean ± SD, n = 3)

	α-SMA	ET-1
Normal control group	0.457 ± 0.055	0.593 ± 0.006
Untreated cirrhotic group	0.929 ± 0.036b	1.034 ± 0.112b
Transplantation group	0.502 ± 0.066d	0.607 ± 0.012d

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. SMA: Smooth muscle actin; ET: Endothelin.

Table 8 Effects of embryonic hepatocyte transplantation in rats on different mRNA expression (mean ± SD, n = 9)

	STAP	c-myb	α-SMA	ET-1
Normal control group	1.000 ± 0.2667	1.000 ± 0.250	1.000 ± 0.2446	1.000 ± 0.3191
Untreated cirrhotic group	44.97 ± 19.40b	22.32 ± 5.536b	45.65 ± 11.98b	8.021 ± 1.191b
Transplantation group	1.133 ± 0.2222d	0.7143 ± 0.5714d	1.094 ± 0.1974d	1.010 ± 0.3298d

^bP < 0.01 vs the normal control group;

^dP < 0.01 vs the untreated cirrhotic group. STAP: Stellate activation-associated protein; SMA: Smooth muscle actin; ET: Endothelin.