Apoptotic activity of caged xanthones from Garcinia hanburyi in cholangiocarcinoma cell lines

Table 1 Primer sequences used for target gene amplification

GenBank accession No.	Gene	Forward primer	Reverse primer
M14745.1	Bcl-2	TGGATGACTGAGTACCTGA	TGAGCAGAGTCTTCAGAGA
L22473.1	Bax	AACCATCATGGGCTGGA	CGCCACAAAGATGGTCA
AF077350.1	Survivin	AAGGCTGGGAGCCAGA	TGGCTCTTTCTCTGTCCA
BC083511	GAPDH	TCATCAGCAATGCCTCCTGCA	TGGGTGGCAGTGATGGCA

Table 2 Concentrations of four caged xanthones and doxorubicin causing a 50% inhibitory effect (IC₅₀) in cell proliferation

Cells	IC50 values (μmol/L)
	Isomorellin	Isomorellinol	Forbesione	Gambogic acid	Doxorubicin
KKU-100	0.11 ± 0.004	2.2 ± 0.33	0.15 ± 0.007	2.64 ± 1.29	0.66 ± 0.001
KKU-M156	0.12 ± 0.005	0.43 ± 0.06	0.02 ± 0.002	0.03 ± 0.004	0.36 ± 0.001
PBMC	> 88 × 104	59 ± 2.9	59.5 ± 1.0	11 ± 3	ND

Data are mean ± SE of three independent experiments. ND: Not detected.

Table 3 Percentage of apoptotic cells in the four caged xanthone-treated and non treated CCA cell lines

Compounds	% apoptotic cells
	KKU-100 (h)		KKU-M156 (h)
	36	48	24	36
Control	8 ± 1.45	13 ± 0.66	8 ± 0.88	23 ± 0.66
Isomorellinol	44 ± 2.31b	79 ± 1.76b	34 ± 1.50b	89 ± 1.20b
Forbesione	34 ± 0.67b	78 ± 1.15b	38 ± 3.17b	83 ± 3.05b
Gambogic acid	32 ± 0.87b	70 ± 1.45b	17 ± 1.50a	72 ± 0.66b
Isomorellin	25 ± 1.21b	69 ± 1.76b	31 ± 0.58b	77 ± 4.16b

Data are mean ± SE of three independent experiments.

^aP < 0.05,

^bP < 0.01 vs control. CCA: Cholangiocarcinoma.

Table 4 Bax/Bcl-2 ratios of the four caged xanthone-treated and non treated CCA cell lines

Compounds	Bax/Bcl-2 ratio
	KKU-100 (h)				KKU-M156 (h)
	0	12	24	48	0	12	24	48
Isomorellinol	0.98	1.58	1.98	120	0.73	1.04	1.43	41.40
Forbesione	1.02	1.93	2.35	2.91	1.53	2.38	5.12	7.02
Gambogic acid	0.81	1.51	3.42	7.00	0.43	0.72	1.83	3.14
Isomorellin	0.98	1.98	3.12	5.20	0.56	0.70	1.00	1.90

Data are expressed as ratio of mean of protein expression level of Bax to Bcl-2 in control and the caged xanthone-treated CCA cell lines.

Table 5 Fold decrease or increase of apoptotic-related proteins of the four caged xanthone-treated compared to non treated CCA cell lines

Apoptotic proteins	Compounds	Fold change in protein of the treated cells compared to control cells
		KKU-100 (h)				KKU-M156 (h)
		0	12	24	48	0	12	24	48
Activated caspase-9	Isomorellinol	1	54	56	55	1	1	58	49
	Forbesione	1	9.6	13.1	13	1	5.7	8	5.6
	Gambogic acid	1	30	78	60	1	2.6	4.5	3.9
	Isomorellin	1	6.3	12.3	9.3	1	1	29	34
Activated caspase-3	Isomorellinol	1	10.6	11	11.2	1	20.2	30.4	33
	Forbesione	1	6	9.6	12	1	5.7	9.6	10
	Gambogic acid	1	5.5	7.5	12.2	1	28	39.3	46.7
	Isomorellin	1	8.9	10	13	1	5	5.7	12
Survivin	Isomorellinol	1	0.8	0.7	0.01	1	0.8	0.6	0.01
	Forbesione	1	0.5	0.54	0.3	1	0.7	0.54	0.5
	Gambogic acid	1	0.6	0.4	0.3	1	0.7	0.6	0.4
	Isomorellin	1	0.6	0.5	0.3	1	0.8	0.5	0.3
AIF	Isomorellinol	1	1.6	1.9	2.3	1	1.6	1.9	2.2
	Forbesione	1	1.2	1.6	2.1	1	1.6	2.8	4
	Gambogic acid	1	1.5	1.6	2.7	1	1.6	2.1	3.4
	Isomorellin	1	1.9	3.3	3.5	1	1.3	1.7	2.5

Data are expressed as ratio of mean of protein expression level of the apoptotic-related proteins in the caged xanthone-treated to non treated CCA cell lines.