Comprehensive screening for reg1α gene rules out association with tropical calcific pancreatitis

Table 1 Primer sequences and PCR conditions for the reg1α gene

Primer	Sequence (5'-3')	Tann (°C)
1F	TGTCCCAATTCATATACTTA	50
1R	GCATGTTAGAGACGCCCTTC
2F	CGGGAAAAGGCTCGTACTGG	60
2R	TCAGTTCTCCACCCCATTAG
3F	TAAAAGGGAAACTGGAGACT	56
3R	CCTCCTTCTTACTTCTCAAA
4F	TGCACTGTAGATGATTGGAG	62
4R	AAAGACTGGGGTAGGTAAAACT
4F-INT1	TCTTGGTGGAATACAGTTAA	Seq
4F-INT2	AATGGATGTTTGGTTTTTGT	Seq

F: Forward; R: Reverse; T_ann: Annealing temperature; INT: Internal primer for sequencing.

Table 2 Distribution of polymorphisms in reg1α gene in patients with tropical calcific pancreatitis and healthy controls

Polymorphism2	rs number	Position5	Minor allele frequency		OR (95% CI)	P Value
			Patients (n = 195)	Controls (n = 150)
G-974C4	rs283887	79200522	0.01	0.02	0.49 (0.02-7.10)	1.001
G-938A	rs1349077	79200558	0.34	0.33	1.05 (0.56-1.96)	0.88
T-912G	rs283888	79200584	0.49	0.50	0.94 (0.54-1.78)	0.84
G-501A4	rs283889	79200995	0.01	0.02	0.49 (0.02-7.10)	1.001
T-385C	rs10165462	79201111	0.32	0.29	1.15 (0.60-2.20)	0.65
-331delGGA3	-	-	0.01	0.01	1.00	1.001
T-243G	rs283890	79201253	0.34	0.35	1.09 (0.75-1.58)	0.63
G209T	rs2070707	79201704	0.20	0.17	1.29 (0.78-2.12)	0.29
G2199A	rs3739142	79203694	0.34	0.34	1.01 (0.70-1.48)	0.94
G2370A34	-	-	0.01	0.03	0.33 (0.01-3.60)	0.611

AA: Amino acid; OR: Odds ratio; CI: Confidence interval;

¹Yates corrected P value;

²Nomenclature as per NCBI sequence Accession No. NT_022184;

³Novel polymorphism;

⁴Data from 50 patients & 50 controls;

⁵Chromosomal location according to UCSC Genome Browser, March 2006 build (dbSNP build 126).

Table 3 Comparison of reg1α gene polymorphisms in FCPD and TCP patients, and controls

SNP1	Minor allele frequency			FCPD vs TCP		FCPD vs Controls		TCP vs Controls
	FCPD (n = 94)	TCP (n = 101)	Controls (n = 150)	OR (95% CI)	P value	OR (95% CI)	P value	OR (95% CI)	P value
G-938A	0.36	0.32	0.33	1.20 (0.64-2.24)	0.55	1.14 (0.61-2.13)	0.66	0.96 (0.51-1.80)	0.88
T-912G	0.47	0.51	0.50	0.85 (0.47-1.54)	0.57	0.89 (0.49-1.60)	0.67	1.04 (0.58-1.88)	0.89
T-385C	0.31	0.30	0.29	1.05 (0.55-2.00)	0.88	1.10 (0.57-2.11)	0.76	1.05 (0.55-2.02)	0.88
T-243G	0.33	0.35	0.35	0.91 (0.49-1.71)	0.77	0.91 (0.49-1.71)	0.77	1.00	1.00
G209T	0.24	0.17	0.17	1.54 (0.73-3.27)	0.22	1.54 (0.73-3.27)	0.22	1.00	1.00
G2199A	0.41	0.33	0.34	1.41 (0.76-2.62)	0.24	1.35 (0.73-2.50)	0.31	0.96 (0.51-1.79)	0.88

SNP: Single nucleotide polymorphism; n: Number of individuals; OR: Odds ratio; CI: Confidence interval; TCP: Tropical calcific pancreatitis; FCPD: Fibrocalculous pancreatic diabetes;

¹Only SNPs with > 3% minor allele frequency have been presented; The minor allele frequency at each polymorphism was compared between the three groups and P value with OR and 95% CI were calculated.

Table 4 Genotype data of polymorphisms analyzed in reg1α gene

Polymorphism	Patients (n = 195)			Controls (n = 150)
	AA	Aa	aa	AA	Aa	aa
G-974C1	49	1	0	48	2	0
G-938A	92	73	30	74	52	24
T-912G	53	93	49	42	65	43
G-501A1	49	1	0	48	2	0
T-385C	98	76	21	80	52	18
-331delGGA	193	2	0	148	2	0
T-243G	92	73	30	69	58	23
G209T	125	61	9	103	43	4
G2199A	94	68	33	72	54	24
G2370A1	49	1	0	47	3	0

AA: Homozygous for major allele; Aa: Heterozygous; aa: Homozygous for minor allele.

¹Data from 50 patients & 50 controls.

Table 5 Haplotype frequencies of reg1α gene in patients with tropical calcific pancreatitis and healthy controls

S. No.	Haplotype	Haplotype frequency (%)		OR (95% CI)	P value
		Patients (n = 195)	Controls (n = 150)
1	G G T G G G	43.1	43.3	~1	~1
2	A T C T G A	30.3	31.3	0.95 (0.5-1.82)	0.88
3	G T T G T G	19.0	17.3	1.15 (0.52-2.5)	0.33
4	G G T T G G	2.1	2.0	~1	~1

OR: Odds ratio; 95% CI: 95% confidence interval; Haplotypes generated using six SNPs with minor allele frequency of > 3%, haplotypes with frequency > 2% are presented; Order of SNPs; G-938A, T-912G, T-385C, T-243G, G209T, G2199A in the reference sequence.

Table 6 Distribution of reg1α gene polymorphisms in tropical calcific pancreatitis patients based on N34S SPINK1 and L26V CTSB status

SNP	SPINK1 mutation				CTSB mutation
	Minor allele frequency1		OR (95% CI)	P value	Minor allele frequency2		OR (95% CI)	P value
	N34S (n = 48)	WILD (n = 82)			L26V (n = 105)	WILD (n = 73)
G-938A	0.33	0.34	0.96 (0.51-1.79)	0.88	0.34	0.31	1.15 (0.61-2.16)	0.65
T-912G	0.49	0.45	1.17 (0.65-2.13)	0.57	0.43	0.54	0.64 (0.35-1.17))	0.12
T-385C	0.31	0.33	0.91 (0.48-1.73)	0.76	0.31	0.26	1.28 (0.66-2.48)	0.43
T-243G	0.33	0.39	0.77 (0.41-1.43)	0.38	0.34	0.31	1.15 (0.61-2.16)	0.65
G209T	0.18	0.21	0.83 (0.39-1.76)	0.59	0.23	0.19	1.27 (0.61-2.66)	0.49
G2199A	0.34	0.35	0.96 (0.51-1.79)	0.88	0.38	0.27	1.66 (0.87-3.15)	0.10

SNP: Single nucleotide polymorphism; n: Number of individuals; OR: Odds ratio; CI: Confidence interval;

¹Minor allele frequency based on N34S SPINK1 status;

²Allele frequency based on L26V CTSB status.