Gene expression profiles in peripheral blood mononuclear cells of SARS patients

Table 1 Clinical characteristics of two SARS patients

	P1	P2
Age (yr)	57	40
Gender	Male	Female
Body temperature (°C)	39.2	36.8
White cell count (×109/L)	13.3	4.67
Neutrophil (×109/L)	12.8	3.25
Lymphocyte (×109/L)	0.406	0.897
CD3+ (/µL)	359	791
CD4+CD3+/CD3+ (%)	86	58
CD8+CD3+/CD3+ (%)	13	36
CD4+CD8+CD3+/CD3+ (%)	4	2
CD4+/CD8+	6.38	1.62
Monocyte (×109/L)	0.122	0.442
Eosinophil (×109/L)	0.004	0.033
Basophil (×109/L)	0.009	0.041
Outcome	Death	Rehabilitation

Table 2 Primer sequence used in real-time quantitative PCR analysis

Accession number	Description	Forward primer (5’→3’)	Reverse primer (5’→3’)
NM_000634	IL-8R α	GGAACTGGTGTCTTCAGGG	CATCTAATGTCAGATTCGGGG
NM_003855	IL-18R1	GGGTATTACTCCTGCGTGCA	CCATTTTCTTCCCCGAACATCC
BC025925	GAPDH	GGTATCGTGGAAGGACTCATGAC	ATGCCAGTGAGCTTCCCGTTCAGC

Table 3 Comparison of microarray and real-time quantitative PCR analysis on selected genes (mean±SD)

Gene description	Techniques	P1	P2
IL-8R α	Microarray	73.52	–
	Real-time qPCR	11.63±0.15	0.37±0.09
IL-18R1	Microarray	42.33	–
	Real-time qPCR	48.55±0.36	0.38±0.27

Table 4 Functional categories of over 2.0-fold-regulated genes in two SARS patients

Classification	P1	P2
Cell communication	802 (518↑284↓)	288 (116↑172↓)
Cell differentiation	65 (33↑32↓)	24 (6↑12↓)
Cellular physiological process	1 056 (645↑411↓)	406 (188↑218↓)
Coagulation	42 (25↑17↓)	17 (6↑11↓)
Development	316 (202↑114↓)	132 (50↑82↓)
Death	166 (116↑50↓)	80 (45↑35↓)
Extracellular structure	3 (1↑2↓)	2 (2↓)
organization and biogenesis
Homeostasis	30 (13↑17↓)	11 (8↑3↓)
Metabolism	1 497 (867↑630↓)	512 (191↑330↓)
Obsolete biological process	1 (1↓)	1 (1↓)
Organismal physiological process	467 (278↑189↓)	198 (110↑88↓)
Pathogenesis	1 (1↑)	2 (2↑)
Regulation of cell process	57 (57↓)	88 (48↑40↓)
Response to stimulus	532 (317↑215↓)	232 (124↑108↓)
Viral life cycle	15 (7↑8↓)	10 (5↑5↓)
Behavior	14 (8↑6↓)	6 (1↑5↓)
Total	3 854 (2 273↑1 581↓)	1 380 (527↑853↓)

Table 5 Differentially expressed genes encoding pro- and anti-inflammatory cytokines are involved in IL-1 and TNF-α signaling cassettes in two patients

GenBank access	Definition	P1	P2
Pro- and anti-inflammatory cytokines and receptors
AF043337	IL-8	8	–2.46
NM_000634	IL-8 receptor, α	73.52	–
NM_001557	IL-8 receptor, β	51.98	4.29
NM_000575	IL-1, α	3.73	–
NM_000576	IL-1, β	6.5	11.31
NM_000877	IL-1 receptor, type I	18.38	–
NM_004633	IL-1 receptor, type II	362.04	3.84
U64094	Soluble type II IL-1 receptor	630.35	–
NM_003856	IL-1 receptor-like 1	11.31	3.25
U65590	IL-1 receptor antagonist IL-1Ra	14.93	–
AF051151	Toll/IL-1 receptor-like protein 3	14.93	–
NM_000418	IL-4 receptor	13.93	–
NM_000600	IL-6	–	3.03
NM_002184	IL-6 signal transducer gp130	–	–2.14
BC001903	IL-10 receptor, β	4	–
NM_004512	IL-11 receptor, α	–6.06	–2.30
NM_001560	IL-13 receptor, α1	3.25	–
U62858	IL-13 receptor	5.66	–
U81380.2	IL-13 receptor soluble form	4.29	–
NM_000585	IL-15	–3.03	2
NM_004513	IL-16	–	–2.83
NM_014339	IL-17 receptor	4.29	–
NM_003855	IL-18 receptor 1	42.22	–
NM_003853	IL-18 receptor accessory protein	19.7	–
AF269133	Novel interleukin receptor	–3.03	–
NM_004862	TNF-α	17.15	–
NM_001065	TNFRSF1A	4	–
NM_003841	TNFRSF10C	19.7	–
NM_000760	G-CSF 3 receptor	25.99	–
BC002635	GM-CSF 2 receptor, α, low-affinity	3.03	–
M64445	GM-CSF receptor	4.92	2.64
NM_002607	Platelet-derived growth factor α polypeptide	–2.46	–
NM_004347	Caspase 5	4.59	–
NM_000201	Intercellular adhesion molecule 1	17.15	–
NM_002162	Intercellular adhesion molecule 3	6.28	–
NM_003243	Transforming growth factor, β receptor III	–36.76	–4.59
NM_003242	Transforming growth factor, β receptor II	–	–2.30
NM_000358	Transforming growth factor, β-induced, 68 ku	–24.25	–
The genes involved in the IL-1 signaling pathway
NM_007199	IL-1 receptor-associated kinase M	19.7	–
NM_002182	IL-1 receptor accessory protein	25.99	–
AF167343	Soluble IL-1 receptor accessory protein	55.72	–
M87507	IL-1 β convertase	3.25	–
U13698	IL-1-β converting enzyme isoform γ	3.03	–
U13699	IL-1-β converting enzyme isoform δ	–	2.14
U13700	IL-1-β converting enzyme isoform ε	2.64	–
The TNF signal downstream genes
NM_004619	TNF receptor-associated factor 5	–	–2.00
NM_016614	TRAF and TNF receptor-associated protein	3.84	–2.30
NM_006290	TNF-α induced protein 3	5.66	–
NM_007115	TNF-α induced protein 6	45.25	4.92
AB034747	Small integral membrane protein of lysosome late endosome	7.46	–
U50062	RIP protein kinase	–	–2.00

Table 6 Differentially expressed genes involved in immune regulation in two SARS cases

GenBank access	Definition	P1	P2
IFN and IFN-induced genes
M29383	IFN-γ	–	2.14
NM_000416	IFN-γ receptor 1	4.59	–
NM_005534	IFN-γ receptor 2	3.84	–
NM_000629	IFN (α, β, and ω) receptor 1	4.29	–
NM_002198	IFN regulatory factor 1	–	3.84
NM_002460	IFN regulatory factor 4	–	–2.30
NM_004030	IFN regulatory factor 7	–	3.25
BC001356	IFN-induced protein 35	–	2.83
M34455	IFN-γ-inducible indoleamine 2,3-dioxygenase	–	5.66
NM_001548	IFN-induced protein with tetratricopeptide repeats 1	–	3.03
NM_001549	IFN-induced protein with tetratricopeptide repeats 4	–	6.06
NM_002053	Guanylate binding protein 1, IFN-inducible	–	3.03
NM_004120.2	Guanylate binding protein 2, IFN-inducible	–	3.73
NM_022873	IFN-α-inducible protein	–	6.5
NM_003641	IFN-induced transmembrane protein 1 (9-27)	–	2.3
NM_004509	IFN-induced protein 41	–	2.14
NM_005532	IFN-α inducible protein 27	–	14.93
NM_005101	IFN-stimulated protein, 15 ku	–	6.5
NM_006417	IFN-induced, hepatitis C-associated microtubular aggregate protein	–2.46	2.64
NM_002759	PKR	–	2.14
NM_002462	Mx1	–	2.14
Chemokines and receptors
NM_001511	GRO1	55.72	–
NM_002993	Granulocyte chemotactic protein 2	3.73	–
NM_001565	CXCL10	–	14.93
AF030514	CXCL11	–	18.38
AJ224869	CXCR4	6.5	2.83
M21121	RANTES	–13.93	–
NM_001295	CCR1	3.84	–
NM_000648	CCR2	–9.19	–3.25
NM_001837	CCR3	–	6.5
NM_000579	CCR5	–3.25	–4.00
NM_001838	CCR7	–3.73	–2.64
U20350	CX3CR1	–42.22	–
Toll-like receptors
NM_003264	Toll-like receptor 2	8	–
NM_003265	Toll-like receptor 3	–3.25	–2.30
NM_003266	Toll-like receptor 4	3.73	–2.64
NM_016562	Toll-like receptor 7	–17.15	2.3

Table 7 Differentially expressed genes involving MAPK or JAK-STAT signaling pathways in two SARS cases

GenBank access	Definition	P1	P2
U35002	JNK2 β1 protein kinase	–2.00	–2.14
U31601	JAK-3B	10.56	–
NM_007315	STAT-1	–	2.14
NM_005419	STAT-2	–	3.03
NM_003151	STAT-4	–2.30	–
NM_012448	STAT5B	8.57	–
AB005043	STAT induced STAT inhibitor 1	5.66	3.03
NM_003955	STAT induced STAT inhibitor 3	4.92	–
NM_002745	MAPK 1	4	–
NM_002748	MAPK 6	3.73	–
NM_001315	MAPK 14	9.19	–
NM_004759	MAPK-activated protein kinase 2	4.29	–
NM_003668	MAPK-activated protein kinase 5	–2.46	–
NM_001674	Activating transcription factor 3	2.46	5.27
NM_007348	Activating transcription factor 6	3.73	–