MUC1 and MUC5AC mucin expression in liver fluke-associated intrahepatic cholangiocarcinoma

Table 1 Sequences of primers and TaqMan^® probe for MUC1 and MUC5AC apomucins

Mucin	Primer or probe	Sequence	Product size
MUC1	Forward	GCTATGTGCCCCCTAGCAGTAC	73
	Reverse	AGGCTGCTGCCACCGTTA
	Probe	TCGTAGCCCCTATGAGAAGGTTTCTGCAG
MUC5AC	Forward	CCCCAACATCAGGAACAGCTT	147
	Reverse	GAGTAGTAGGTTCCCGGCTTCA
	Probe	AGCGTGGAGAATGAGAAGTATGCTCAGCAC

Table 2 Expression of MUC1 and MUC5AC apomucins, demographic data, cancer histopathology, and clinical staging of ICC patients

	Variables	n (87)	%
Age (yr)	≤56	42	48.3
	>56	45	51.7
Sex	Male	59	67.8
	Female	28	32.2
Tumor staging	I–III	14	16.1
	IVA	16	18.4
	IVB	57	65.5
Histological grading	Papillary	20	22.9
	Well-differentiated	26	29.8
	Moderately differentiated	11	12.6
	Poorly differentiated	20	22.9
	Unclassified	10	11.5
Tumor size	≤5 cm	24	27.6
	>5 cm	63	72.4
Vascular invasion	No	30	34.5
	Yes	57	65.5
Neural invasion	No	46	52.9
	Yes	41	47.1
Lymphatic invasion	No	23	26.4
	Yes	64	73.6
Mucin expression	MUC1 and MUC5AC	52	59.7
	MUC1 only	15	17.3
	MUC5AC only	12	13.8
	None	8	9.2
MUC1 expression	Low (0, 1+)	53	60.9
	High (2+, 3+)	34	39.1
MUC5AC expression	Low (0, 1+)	41	47.1
	High (2+, 3+)	46	52.8

Table 3 Expressions of MUC1 and MUC5AC apomucins in ICC in relation to patients’ cancer histopathology and clinical staging

Variables	MUC1		P	MUC5AC		P
	Low	High		Low	High
Age (yr)	53	34	0.894	41	46	0.065
≤56	26	17		15	27
>56	27	17		26	19
Gender	53	34	0.698	41	46	0.058
Male	34	24		32	26
Female	19	10		9	20
Histological grading	43	24	0.575	34	33	0.095
Papillary	13	7		11	9
Well-diff.	18	8		9	17
Moderately diff.	5	6		6	5
Poorly diff.	7	3		8	2
Tumor size	51	31	0.964	38	44	0.502
≤5 cm	15	9		13	11
>5 cm	36	22		25	33
Staging	50	32	0.94	39	43	0.008
I-III	8	5		6	7
IVA	6	5		10	1
IVB	36	22		23	35
Vascular invasion	53	34	<0.001	41	46	0.284
No	27	2		17	14
Yes	26	30		24	32
Lymphatic invasion	53	34	0.995	41	46	0.124
No	14	9	14	9
Yes	39	25		27	37
Neural invasion	53	34	0.384	41	46	0.022
No	30	16		27	19
Yes	23	18		14	24

diff. = differentiation.

Table 4 Significant prognostic factors for disease-free survival by multivariate analysis

Variables	Crude HR (95%CI)	Adjusted HR (95%CI)	P
MUC1 expression			0.026
Low	1	1
High	2.59 (1.54-4.35)	2.19 (1.11-4.32)
MUC5AC expression			0.059
Low	1	1
High	1.36 (0.83-2.24)	2.06 (0.96-4.41)
Age (yr)			0.571
≤56	1	1
>56	0.86 (0.53-1.42)	1.19 (0.65-2.17)
Gender			0.128
Male	1	1
Female	0.63 (0.37-1.09)	0.60 (0.31-1.18)
Histological grading			<0.050
Papillary	1	1
Well-differentiated	1.86 (0.91-3.83)	1.92 (0.82-4.49)
Moderately differentiated	3.65 (1.59-8.41)	3.00 (1.10-8.20)
Poorly differentiated	1.78 (0.70-4.53)	3.02 (0.97-9.41)
Staging			<0.050
I–III	1	1
IVA	2.49 (0.81-7.62)	5.10 (1.27-20.43)
IVB	3.57 (1.41-9.00)	3.93 (1.47-10.51)