Do the expressions of gap junction gene connexin messenger RNA in noncancerous liver remnants of patients with hepatocellular carcinoma correlate with postoperative recurrences?

Table 1 Characteristics of 79 patients with HCC undergoing curative resection.

Variables	No. of patients (%)
Age (mean, yr)	56.4±12.6
Male	52 (65.8)
Cirrhosis	57 (72.2)
Child-Pugh’s class A	55 (70.0)
Serum AFP <20 ng/mL	30 (38.0)
20-103 ng/mL	29 (36.7)
>103 ng/mL	20 (25.3)
HBsAg (+)	60 (57.8)
Anti-HCV (+)	41 (51.9)
Size of HCC <3 cm	24 (30.4)
3-10 cm	25 (31.6)
>10 cm	30 (38.0)
Edmondson-Steiner’s grade I	4 (5.1)
grade II	30 (38.0)
grade III	42 (53.2)
grade IV	3 (3.8)
Complete capsule	61 (77.3)
Vascular permeation	56 (70.9)
Daughter nodules	44 (55.7)
Tumor necrosis	55 (70.0)
Tumor hemorrhage	24 (30.4)

AFP: serum alpha fetoprotein; HBsAg (+): positive hepatitis B surface antigen; Anti-HCV (+): positive hepatitis C virus antibody; Edmondson Steiner grade: differentiation grade.

Table 2 Nucleotide sequences of the primer sets and specific oligonucleotide probes to each type of connexin 5'-noncoding mRNA.

Type of connexin mRNA	Primers Probes	Nucleotide sequences
Cx32	Sense	5 CTGCTCTACCCGGGCTATGC
	Antisense	5 CAGGCTGAGCATCGGTCGCTCTT
Cx26	Sense	5 CCGAAGTTCATGAAGGGAGAGAT
	Antisense	5 GGTCTTTTGGACTTCCCTGAGCA
Cx43	Sense	5 TACCATGCGACCAGTGGTGCGCT
	Antisense	5 GAATTCTGGTTATCATCGTCGGGGAA

Table 3 Comparison of characteristics of primary HCC between different levels of connexin 32 mRNA in noncancerous liver tissues.

Characteristics	Group A (n = 64,%)	Group B (n = 15,%)	P
Age (mean, yr)	52.3	48.8	N.S.
Male	65.6	66.7	N.S.
Liver cirrhosis	68.8	73.3	N.S.
Child- Pugh’s class A	76.6	53.3	N.S.
Tumor size <3 cm	35.9	40
>10 cm	34.4	13.3	N.S.
HBsAg (+)	53.1	46.6	N.S.
Anti-HCV (+)	78.1	66.7	N.S.
Serum AFP <20 ng/mL	21.9	40
>1000 ng/mL	37.5	40	N.S.
Tumor necrosis	76.6	53.3	N.S.
Tumor hemorrhage	35.9	40	N.S.
Edmondson-Steiner grade Ia	1.6	20	0.02
Capsule incomplete or absentb	78.1	40	0.009
Daughter nodules	60.9	33.3	0.053
Vascular permeationc	76.6	40	0.011

Low Cx 32 mRNA: <0.800 (group A), high Cx 32 mRNA: ≥0.800 (group B). P: The P value of univariate analysis. a, b, and c: the significant variables in multivariate analysis with P values of 0.0120, 0.0420 and 0.019 respectively. AFP: alpha-fetoprotein, NS: no statistical significance.

Table 4 Comparison of recurrence, death, recurrence, free interval and survival between different levels of Cx 32 mRNA in noncancerous liver tissues.

Outcome	Group A (n = 64)	Group B (n = 15)	P
Recurrence (number) (%)	49 (76.6)	6 (40.0)	0.0107
Death1 ( number) (%)2	25 (39.0)	1 (6.7)	0.0002
Recurrence free interval (median, mo)	8.5	43	0.0595
Duration of survival (median, mo)	11.5	41.5	0.062
	Variables	P	OR
	Recurrence
	Vascular permeation	0.0002	5.36
	Cellular dedifferentiation	0.0203	4.18
	Incomplete or absent capsule	0.016	3.1
	Lower Cx 32 mRNA in liver remnant	0.0203	4.18
	Lower Cx 26 mRNA in liver remnant	0.088	2.29
	Higher Cx 43 mRNA in liver remnant	0.071	2.38
	Death
	Vascular permeation	<0.0001	8.35
	Lower Cx 32 mRNA in liver remnant	0.0333	3.8
	Lower Cx 26 mRNA in liver remnant	0.124	2.1
	Higher Cx 43 mRNA in liver remnant	0.0866	2.4

Note: Low Cx 32 mRNA: <0.800 (group A), high Cx 32 mRNA: ≥0.800 (group B), Death1 : patients died of HCC recurrence. 2: percent of recurrence patients.

Table 5 Factors influencing tumor recurrence and death of patients in multivariate analysis.

Variables	P	OR
Recurrence
Vascular permeation	0.0002	5.36
Cellular dedifferentiation	0.0203	4.18
Incomplete or absent capsule	0.016	3.1
Lower Cx 32 mRNA in liver remnant	0.0203	4.18
Lower Cx 26 mRNA in liver remnant	0.088	2.29
Higher Cx 43 mRNA in liver remnant	0.071	2.38
Death
Vascular permeation	<0.0001	8.35
Lower Cx 32 mRNA in liver remnant	0.0333	3.8
Lower Cx 26 mRNA in liver remnant	0.124	2.1
Higher Cx 43 mRNA in liver remnant	0.0866	2.4

OR: odds ratio; Lower Cx 32 mRNA: value <0.800.