Viral Hepatitis Open Access
Copyright ©The Author(s) 2003. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jul 15, 2003; 9(7): 1516-1520
Published online Jul 15, 2003. doi: 10.3748/wjg.v9.i7.1516
A novel stop codon mutation in HBsAg gene identified in a hepatitis B virus strain associated with cryptogenic cirrhosis
Xu Yang, Xiao-Peng Tang, Jian-Hua Lei, Hong-Yu Luo, Yong-Hong Zhang, Liver Disease Research Center, The Second Xiangya Hospital, Central South University, Changsha 410011, Hunan Province, China
Author contributions: All authors contributed equally to the work.
Correspondence to: Dr Xu Yang, Liver Disease Research Center, The Second Xiangya Hospital, Central South University, 86 Ren Min Avenue, Changsha 410011, Hunan Province, China yangxu@vip.163.com
Telephone: +86-731-5524222-2263 Fax: +86-731-5533525
Received: March 4, 2003
Revised: March 24, 2003
Accepted: April 1, 2003
Published online: July 15, 2003

Abstract

AIM: HBsAg is the most important serological marker for acute or chronic hepatitis B. Nevertheless, there were reports of HBsAg-negative infection caused by hepatitis B virus in recent years. We had a patient with crytogenic cirrhosis who was negative for HBsAg, positive for anti-HBs and HBeAg. This paper was to explore the pathogenic and molecular basis of the unusual serological pattern.

METHODS: HBV serologic markers were qualitatively and quantitatively determined. HBV DNA in serum was qualitatively tested using routine Polymerase chain reaction(PCR), and the viral level was determined with real-time fluorescence quantitative PCR. HBsAg gene was amplified and cloned. Four clones were sequenced. The new genomic sequences were compared with GenBank on the DNA level as well as the protein level.

RESULTS: The qualitative results of serological markers were HBsAg(-), anti-HBs(+), HBeAg(+), anti-HBe(-) and anti-HBc(+). The quantitative results of serological marker were HBsAg (S/N): 0.77 (cut off of S/N: ≥ 2.00), HBeAg (S/N): 56.43 (cut off S/N: ≥ 2.10), anti-HBc (S/CO): 2.03 (cut off of S/CO: ≤ 1.00). The viral level was as high as 1.54 × 109 copies/ml. Sequencing of the HBsAg gene clones revealed a unique point mutation at nucleotide 336 (C to A), which resulted in a novel stop codon at aa 61. The novel HBsAg gene stop mutation had not been described.

CONCLUSION: The lack of detection of HBsAg in the presence of high viral levels of replication may be caused by the existence of viral genomes harboring point mutations which resulted in stop codon upstream of the “a” determinant in HBsAg gene.




INTRODUCTION

Hepatitis B virus (HBV) is a small DNA-containing virus with 4 overlapping open reading frames. The four genes are core, surface, X and polymerase. The surface antigen open reading frame is divided into three regions, pre-S1, pre-S2 and S, which encode three envelope proteins respectively termed large, middle and major protein. All the three envelope proteins contain the major protein, HBsAg, which consists of 226 amino acids and is the predominant protein of the 20 nm small spherical particles representing circulation excess surface protein[1,2].

Serological evidence for acute or chronic hepatitis B is provided most commonly by assays detecting the HBsAg. Its detection is believed to prove the presence of hepatitis B virus in the liver and the peripheral blood. Both the clearance of HBsAg from serum and the appearance of antibodies to HBsAg (anti-HBs) are associated with a resolution of hepatitis in acute or chronic hepatitis B infection[3]. However, the development of polymerase chain reaction (PCR) technique has permitted the detection of very low levels of HBV in patients. There are a number of reports of HBsAg-negative virus carriers[4,5]. Moreover, even cases of anti-HBs-positive carriers have been described although antibodies against the viral envelope usually neutralize the virus and confer protection from infection[6]. China is a highly endemic area for HBV infection, some studies suggested that 30% to 40% of HBsAg-negative patients with cryptogenic cirrhosis, chronic active hepatitis, or chronic persistent hepatitis had HBV-DNA in serum or liver tissue[7]. A well-characterized explanation for the latter pattern is surface mutation. Over the past decade many kinds of surface mutations have been described. We present here a patient with cirrhosis and active viral replication in the presence of anti-HBs. Sequencing of the HBV DNA from the patient revealed a point mutation at nucleotide 336 (C to A) in HBs-gene. This mutation led to a stop codon at 61 amino acids of HBsAg and a premature translation stop, which has not been described elsewhere up to now.

MATERIALS AND METHODS
Case report

The patient was a 56-year-old man. He was positive for HBsAg but asymptomatic in 1988. In 1990 his alanine aminotransferase (ALT) level was slightly elevated. In 1992 he developed a very severe disease which was diagnosed as severe type hepatitis B. He recovered 3 mo later. He felt well from 1992 to 1998, no data about HBV serology and liver function were available during that period. However, he began to feel fatigue, weakness, abdominal distension from the beginning of 1999. His WBC and platelet were markedly decreased, but negative for HBsAg, and positive for anti-HBs. Abdominal ultrasound examination showed splenomegaly. Cryptogenic cirrhosis was diagnosed. Cirrhosis caused by HCV, alcohol, drugs, Wilson's diease and schistosomiasis was excluded. In order to find the cause of the cirrhosis, he came to our hospital in August 2000. Serum was collected at the time and stored at -70 °C until analysis.

HBV serological markers detection

HBsAg, anti-HBs, HBeAg, anti-Hbe, anti-HBc-IgG and anti-HBc-IgM were tested using commercially available standard enzyme immunoassay kit (Kehua Bio-Engineering Co. LTD, Shanghai, China). HBsAg, HbeAg and anti-HBc-IgG were quantitatively determined using Abbott reagent with IMX automatic immunoassay analyzer (Abbott Laboratories, North Chicago, IL), according to the manufacturer's instructions.

Serum HBV DNA detection

HBV DNA detection was carried out using commercially available PCR kit (Liver Research Institute, Beijing Medical University, Beijing, China), according to the manufacturer's instructions. Serum samples (200 μL) were digested with 1 g/L proteinase K and 0.5% sodium dodecyl sulfate (at 37 °C for 2 h), followed by phenol-chloroform extractions and ethanol precipitation. After centrifugation, the pellet was dissolved in 10 μL distilled water. Five μL elute was used for PCR. Thermal cycling conditions were as follows: 35 cycles of amplification were performed at 94 °C for 30 s and at 60°C for 45 s. The PCR products were investigated by staining with ethidium bromide on ultraviolet transilluminatior after electrophoresis in 1.5% agarose gel.

HBV DNA quantification

HBV DNA in serum was quantified using a commercially available real-time fluorescence quantitative PCR (FQ-PCR) kit (Da An Gene Diagnostic Center, Sun Yet-Sen Medical University, Guangzhou, China), in accordance with the manufacturer's instructions. Briefly, 40 μL of serum was mixed with 40 μL of DNA-extracting solution (provided by the kit). The mixture was vortexed and placed in a 100 °C heating block for 10 min, then overnight at 4 °C. The mixture was centrifuged for 5 min at 10000 rpm. Two μL of supernatant was added to the tube containing FQ-PCR core reagent (provided by the kit). FQ-PCR was performed using a GeneAmp 5700 sequence detection system (Perkin Elmer, Foster City, CA). Thermal cycling conditions were as follows: at 93 °C for 2 min for initial denaturation, followed by 40 cycles of at 93 °C for 30 s, at 55 °C for 60 s. Analysis of raw data was done with the GeneAmp 5700 SDS Software (PE Biosystems). Data were collected at the annealing step of each cycle, and the threshold cycle (CT) for each sample was calculated by determining the point at which the fluorescence exceeded the threshold limit. The standard curve was calculated automatically by plotting the CT value against each standard of known concentration and calculation of the linear regression line of this curve. Calculation of the correlation coefficient was done for each run, and the minimal value was 0.98. Sample copy numbers were calculated by interpolation of the experimentally determined standard curve.

Amplification of HBsAg gene

The primers were designed by ourselves according to the sequences published[8,10], which could amplify whole HBsAg gene (from nt 155 to 833). The procedures for HBV DNA extraction were the same as routine PCR described above. The reaction conditions were: the total volume was 30 μL, containing 50 mmol/L KCl , 10 mmol/L tris-HCl (pH9.0), 0.1% triton 100, 0.2 mmol/L dNT, 1.5 mmol/L MgCl2, 15 pmol primer 1 and primer 2, TaqDNA polymerase 2.5 U, a drip of paraffin oil was added on the top of the solution. PCR conditions were as follows: at 94 °C for 5 min for initial denaturation, followed by 30 cycles at 94 °C for 1 min, at 56 °C for 50 s, at 72 °C for 10 s, at 72 °C for 10 min for extension. The PCR products were investigated by staining with ethidium bromide on ultraviolet transilluminatior after electrophoresis in 1.5% agarose gel or used for HBsAg gene cloning.

Forward primer: 5'-GGGAAGCTTATGGAGAACATCACATCAGGATTC-3’

Reverse primer: 5'-CGCGGATCCTTAAATGTATACCCAGAGACAAAA-3’.

Cloning and sequencing of HBsAg gene

The amplified products of HBsAg gene were cloned using pGEM-T easy vectors system kit (Promega Co., Madison, WI.), according to the manufacture's instructions. To detect the vectors containing the PCR products, white/blue colony selection was used. The inserted products were analyzed by electrophoresis in 1% agarose gel after EcoR 1 digestion and PCR (as amplification of HBsAg gene described above). Four clones were sequenced. The sequence of the complete HBsAg gene was obtained by forward and reverse reading of overlapping fragments using ABI PRISM BigDye terminator cycle sequencing ready reaction kit (Perkin Elemer, Foster City, CA). To identify mutations, the new genomic sequences were compared with GenBank on the DNA level as well as the protein level.

RESULTS

All HBV serologic markers were tested repeatedly. HBsAg, HBeAg and anti HBc were tested again using Abbott reagent. The results confirmed that the patient was HBsAg-negative, anti-HBs-positive and HBeAg-positive. It was estimated that the patient had cirrhosis caused by HBV. To confirm the diagnosis, the presence of HBV DNA in serum of the patient was tested using routine PCR and HBV DNA was detected. The quantity of HBV DNA in serum was determined using real-time fluorescent quantitative PCR, which was unexpectedly as high as 1.54 × 109/mL (Table 1 and Table 2).

Table 1 Viral and clinical examination results of the patient.
ItemJan.1999Apr.1999Oct.1999Aug. 2000Nov. 2000Mar. 2001
HBsAg------
Anti-HBs++++++
HbeAg+++++
Anti-Hbe------
Anti-HBc-IgG++++++
Anti-HBc-IgM+-----
HBV DNANdNdNdNd++
HBV DNA copies/mlNdNdNdNd1.02 × 1081.54 × 109
ALT (U/L)49.056.967.174.469.068.6
Albumin (g/L)42.340.438.540.341.540.8
Globulin (g/L)28.630.728.534.431.932.6
Bilirubin (μmol/L)18.923.228.625.827.728.4
Hemoglobin (g/L)NdNdNd111115110
WBC (109/L)NdNdNd2.12.82.6
Platelet (109/L)NdNdNd265840
Table 2 HBsAg, HBeAg and anti-HBc level determined using Abbott reagent.
ItemResultsCut off
HBsAg0.77≥ 2.00(S/N)
HbeAg56.433≥ 2.10(S/N)
Anti-HBc2.033 ≤ 1.0(S/Co)

Due to the massive production of viral particles in the absence of HBsAg and presence of anti-HBs, HBsAg gene mutation, possibly in the "a" determinant, was suspected. Therefore, HBV DNA was extracted from the serum of the patient, HBsAg gene was amplified. After electrophoresis of the PCR products corresponding to the complete HBsAg gene amplified from serum and ethidium bromide staining of the gel, a PCR fragment about 700 bp was detected (the figure was not shown). Then the PCR products of HBsAg gene were cloned, 4 clones were sequenced. The complete sequence of the HBsAg gene was obtained by forward and reverse reading of overlapping fragments (Table 3). All of the 4 clones had the same sequence. The nucleotide and amino acid sequences of the HBsAg gene were compared with GenBank. There were no nucleotide insertions or deletions in the HBsAg gene. Surprisingly, sequencing of the HBsAg gene clones revealed a unique point mutation at nucleotide 336 (C to A), which resulted in a novel stop codon at aa 61. Thus, only a truncated version of HBsAg containing 21 amino acids could be synthesized from this gene, which lacked the entire "a" determinant. The novel HBsAg gene stop codon caused by a point substitution mutation upstream of the "a" determinant of HBsAg gene has not been described up to now.

Table 3 The complete nucleotide sequence of the HBsAg gene from the patient.
ntCodon
155ATGGAGAACATCACATCAGGATTCCCAGGACCCCTGCTCGTATTA15
200CAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCACAG3 0
245AGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAACA45
290CCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAAATCTCCAGTCAC60
335TAACCAACCTGCTGTCCTCCAATTTGTCCTGGTTATCGCTGGATG75
380TGTCTGCGGCGTTTTATCATCTGCCTCTGCATCCTGCTGCTATGC90
425CTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC105
470GTTTGTCCTCTACTTCCAGGATCAACAACAACCAGCACCGGACCA120
515TGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTAAGTTTCCC135
560TCTTGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATT150
605CCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGG165
650GCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTT180
695CAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATA195
740TGGATGATGTGGTTTTGGGGGCCAAGTCTGTACAACATCGTGAGT210
785CCCTTTATGCCGCTGTTACCAATTTTCTTTTGTCTCTGGGTATAC225
830ATTTAA227

The isolate belonged to subtype adw2 according to the amino acid sequence deduced from the nucleotide sequence of the HBsAg gene. The patient's nucleotide sequence and amino acid sequence were compared with a published sequence of the same subtype reported by Ono et al[9] and a Chinese consensus sequence of the same subtype (China J Microbiol Immunol, 1999; 19: 197-200). A two by two analysis of the three nucleotide and amino acid sequences demonstrated a relatively high degree of homogeneity. The nucleotide and amino acid difference was 5.28% and 8.37% between the patient's and Ono's sequences, and was 4.84% and 7.92% between the patient's and the Chinese consensus sequences, respectively. The "a" determinant of the patient's sequence differed from the Ono's sequence by only 2 amino acids and differed from the Chinese consensus sequence by another 2 amino acids, which might reflect the genetic heterogeneity of the same subtype and could not be the mutation (Table 4).

Table 4 Comparison of nucleotide sequences and amino acid sequences of HBsAg gene among the 3 adw subtypes.
Codon491424294547
Sequence(1)ATC IleCTA LeuGTG ValAGA ArgCCG proTCA SerCTA Leu
Sequence(2)ATC IleCCA ProGTA ValAAA LysCCA ProTCA SerGTA Val
Sequence(3)ACA ThrCTA LeuGTG ValAGA ArgCCA ProGCT AlaGTA Val
Codon49565759616471
Sequence(1)CCT proCCA HisACC ThrAAT AsnTCA SerTCC SerGGT Gly
Sequence(2)CTT LeuCAA GluATC IleAGT SerTAA stopTGT CysGGT Gly
Sequence(3)CTT LeuCCA HisACC ThrAAT AsnTCA SerTCT SerGGC Gly
Codon8283859499100110
Sequence(1)ATA IleTTC PheTTC PheTTA LeuGAT AspTAT TyrATT Ile
Sequence(2)ATC IleTGC CysTGC CysTTG LeuGAC AspTAT tyrCTT Leu
Sequence(3)ATA IleTTC PheTTC PheTTG LeuGAC AspTAC TyrCTT Leu
Codon113114115117118122126
Sequence(1)TCA SerACA ThrACA ThrAGT SerACG ThrAAA LysACT Thr
Sequence(2)TCA serTCA SerACA ThrAGC SerACC ThrAAC LysACT Thr
Sequence(3)ACA ThrTCA SerACT ThrAGC SerACG ThrAAG LysATT Ile
Codon130131132136143144146
Sequence(1)GGC GlyAAC AsnAAG LysTCA SerACG ThrGAT AspAAT Asn
Sequence(2)GGA glyACC ThrATG MetTCA SerACG ThrGAC AspAAC Asn
Sequence(3)GGA GlyACC ThrATG MetTCT SerTCG SerGAC AspAAC Asn
Codon148154155160161171190
Sequence(1)ACC ThrTCG SerTCC SerAAA LysTAC ThrTCT SerGTT Val
Sequence(2)ACC ThrTCA SerTCT SerAAA LysTAC ThrTCT SerGTC Val
Sequence(3)ACT ThrTCA SerTCT SerAGA AgrTTC PheTCC serGTT val
Codon194200207209213214215
Sequence(1)GCT AlaTAT ThrAGC SerGTG ValATA IleCCG ProCTC Leu
Sequence(2)GTT ValTTT PheAAC AsnTTG LeuATG metCCG ProCTG Leu
Sequence(3)GTT valTAT ThrAAC AsnTTG LeuTTA LeuCCT ProCTA Leu
Codon222
Sequence(1)CTC Leu
Sequence(2)CTC Leu
Sequence(3)CTT Leu
DISCUSSION

Hepatitis B virus replicates via an RNA intermediate, using a reverse transcriptase that appears to lack a proofreading function. Therefore, HBV exhibits a mutation rate more than 10-fold higher than other DNA virus[10-12]. Mutations in all 4 genes have been described. Surface gene mutation were initially noted as vaccine escape mutants, detected in 2%-3% of children in HBV endemic regions receiving HBV immunoprophylaxis at birth, and also observed in liver transplanted HBV carriers who received hepatitis B immunoglobulin to prevent re-infection of the graft[13-17]. Similar mutations could also arise in the natural course of HBV infection. The prevalence and clinical significance of naturally occurring mutations in full-length surface and overlapping polymerase genes of hepatitis B virus were analyzed in 42 patients with chronic hepatitis, mutations were observed in 10 patients (24%) in the "a" determinant region[18,19].

The surface gene of HBV contains a dominant neutralizing epitope termed "a" determinant located between aa 121-149 of HBsAg, The production of antibodies to the "a" determinant after vaccination usually protects against HBV infection. The surface protein variants noted in most studies were clustered within the "a" determinant, especially the substitution of glycine for arginine at aa 145, which makes this epitope unlikely to bind to antibodies generated to wild-type HBsAg. However, other kinds of mutation outside of the "a" determinant have been described in recent years, including deleting and inserting mutations in the surface gene of HBV[20-22].

In contrast to the mutations mentioned above, an uncommon point mutation at nucleotide 336 (C to A) of HBsAg-gene occurred in our isolates, which resulted in a novel stop codon at aa 61. This finding could not be a laboratory error, because all sequences of four clones were the same. Because of this new stop codon introduction, only truncated molecules of surface antigen could be expressed, which contained only 60 amino acid residues and was lack of the "a" determinant. This unique mutation could well explain the patient's unusual serologic pattern: HBsAg-negative, but HBeAg-positive, anti-HBs-positive and HBV DNA-positive. The novel HBsAg gene stop codon caused by a point substitution mutation upstream of the "a" determinant has not been described up to now. Our finding is very similar to the deletion mutation of HBsAg gene described by Weinberger et al[23]. The deletion mutation located at the nucleotide 31 of the HBsAg gene, which led to a frame-shift and introduced a stop-codon after 21amino acids of HBsAg.

To initiate infection, a virus must attach to a host cell receptor via one of its surface proteins. Hepatitis B virus has three related surface proteins, small S, middle S, and large S. It is not clear which of these three proteins serves as the HBV attachment protein. It has been thought that the pre-S region or S region determines viral binding[24,25]. However, due to the lack of a susceptible cell line that could be used to test specific blocking reagents, which protein is involved in the initial stage of HBV infection is difficult to determine. The HBV DNA level in our patient was as high as 109/mL in serum, indicating that isolates that bear such truncated molecules on their surface (the mutant HBsAg was only equal to one-fourth of HBsAg from wild type) can well finish their life cycle including viral binding and entry. Our finding presented here provides the evidence that sequences in the pre-S region determine viral binding.

However, our finding raises a theoretical question: Cells infected with hepatitis B virus produce both virions and 20nm subviral (surface antigen) particles. Although hepatitis B virus encodes three envelope proteins, all of the information required to produce 20 nm HBsAg particles resides within the S protein[26]. The nucleotide sequence of the HBsAg gene predicts the existence of three hydrophobic domains, located at residues 4 to 28 (signal I), 80 to 100 (signal II) and 164 to 221 (signal III). Studies on certain artificial deletion mutants suggested that deletion of signal II completely destabilized the chain, and deletion of the signal III resulted in a nonsecreted chain[27]. How such a drastically shortened HBsAg which is lack of signal IIand signal III, can be able to form morphologically correct viral and subviral particles Because when co-expressed with wild type S protein, the mutant polypeptide can be incorporated into particles and secreted, therefore, it is assumed that the presence of a minor population of intact genomes helps in replication and formation of intact virions. All virus isolates consist of a mixture of viral strains. Multiple variants have been found in a single host. Advances in molecular biology technique have revealed significant diversities in sequence of of HBV isolates. Sequencing results suggest that there were HBV quasispecies groups in chronically infected patients[28-31]. Actually, electron microscopy of serum samples containing mutated DNA from the patient reported by Weiinberger et al[23] revealed typical subviral particles with an average diameter of 17-20 nm, but did not reveal a single filamentous particle. Our results show that lack of detection of HBsAg in the presence of high viral levels of replication may be caused by the existence of viral genomes harboring point mutation which results in stop codon upstream of the "a" determinant of HBsAg gene.

Footnotes

Edited by Ma JY and Wang XL

References
1.  Tiollais P, Charnay P, Vyas GN. Biology of hepatitis B virus. Science. 1981;213:406-411.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 265]  [Cited by in RCA: 261]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
2.  Michel ML, Tiollais P. Structure and expression of the hepatitis B virus genome. Hepatology. 1987;7:61S-63S.  [PubMed]  [DOI]  [Cited in This Article: ]
3.  Krugman S, Overby LR, Mushahwar IK, Ling CM, Frösner GG, Deinhardt F. Viral hepatitis, type B. Studies on natural history and prevention re-examined. N Engl J Med. 1979;300:101-106.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 201]  [Cited by in RCA: 200]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
4.  Bréchot C, Degos F, Lugassy C, Thiers V, Zafrani S, Franco D, Bismuth H, Trépo C, Benhamou JP, Wands J. Hepatitis B virus DNA in patients with chronic liver disease and negative tests for hepatitis B surface antigen. N Engl J Med. 1985;312:270-276.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 361]  [Cited by in RCA: 358]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
5.  Sánchez-Quijano A, Jauregui JI, Leal M, Pineda JA, Castilla A, Abad MA, Civeira MP, García de Pesquera F, Prieto J, Lissen E. Hepatitis B virus occult infection in subjects with persistent isolated anti-HBc reactivity. J Hepatol. 1993;17:288-293.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 41]  [Cited by in RCA: 41]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
6.  Rehermann B, Ferrari C, Pasquinelli C, Chisari FV. The hepatitis B virus persists for decades after patients' recovery from acute viral hepatitis despite active maintenance of a cytotoxic T-lymphocyte response. Nat Med. 1996;2:1104-1108.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 624]  [Cited by in RCA: 588]  [Article Influence: 20.3]  [Reference Citation Analysis (1)]
7.  Zhang YY, Guo LS, Li L, Zhang YD, Hao LJ, Hansson BG, Nordenfelt E. Hepatitis B virus DNA detected by PCR in sera and liver tissues of Chinese patients with chronic liver diseases. Chin Med J (. Engl). 1993;106:7-12.  [PubMed]  [DOI]  [Cited in This Article: ]
8.  Galibert F, Mandart E, Fitoussi F, Tiollais P, Charnay P. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature. 1979;281:646-650.  [PubMed]  [DOI]  [Cited in This Article: ]
9.  Ono Y, Onda H, Sasada R, Igarashi K, Sugino Y, Nishioka K. The complete nucleotide sequences of the cloned hepatitis B virus DNA; subtype adr and adw. Nucleic Acids Res. 1983;11:1747-1757.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 307]  [Cited by in RCA: 352]  [Article Influence: 8.4]  [Reference Citation Analysis (0)]
10.  Blum HE. Variants of hepatitis B, C and D viruses: molecular biology and clinical significance. Digestion. 1995;56:85-95.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 32]  [Cited by in RCA: 32]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
11.  Carman WF, Thomas HC. Genetic variation in hepatitis B virus. Gastroenterology. 1992;102:711-719.  [PubMed]  [DOI]  [Cited in This Article: ]
12.  Hasegawa K, Huang J, Rogers SA, Blum HE, Liang TJ. Enhanced replication of a hepatitis B virus mutant associated with an epidemic of fulminant hepatitis. J Virol. 1994;68:1651-1659.  [PubMed]  [DOI]  [Cited in This Article: ]
13.  Karthigesu VD, Allison LM, Ferguson M, Howard CR. A hepatitis B virus variant found in the sera of immunised children induces a conformational change in the HBsAg "a" determinant. J Med Virol. 1999;58:346-352.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
14.  He JW, Lu Q, Zhu QR, Duan SC, Wen YM. Mutations in the 'a' determinant of hepatitis B surface antigen among Chinese infants receiving active postexposure hepatitis B immunization. Vaccine. 1998;16:170-173.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 28]  [Cited by in RCA: 30]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
15.  Cooreman MP, Leroux-Roels G, Paulij WP. Vaccine- and hepatitis B immune globulin-induced escape mutations of hepatitis B virus surface antigen. J Biomed Sci. 2001;8:237-247.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 128]  [Cited by in RCA: 134]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
16.  Carman WF, Zanetti AR, Karayiannis P, Waters J, Manzillo G, Tanzi E, Zuckerman AJ, Thomas HC. Vaccine-induced escape mutant of hepatitis B virus. Lancet. 1990;336:325-329.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 817]  [Cited by in RCA: 765]  [Article Influence: 21.9]  [Reference Citation Analysis (0)]
17.  Chen WN, Oon CJ. Hepatitis B virus surface antigen (HBsAg) mutants in Singapore adults and vaccinated children with high anti-hepatitis B virus antibody levels but negative for HBsAg. J Clin Microbiol. 2000;38:2793-2794.  [PubMed]  [DOI]  [Cited in This Article: ]
18.  Hou J, Wang Z, Cheng J, Lin Y, Lau GK, Sun J, Zhou F, Waters J, Karayiannis P, Luo K. Prevalence of naturally occurring surface gene variants of hepatitis B virus in nonimmunized surface antigen-negative Chinese carriers. Hepatology. 2001;34:1027-1034.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 145]  [Cited by in RCA: 157]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
19.  Ghany MG, Ayola B, Villamil FG, Gish RG, Rojter S, Vierling JM, Lok AS. Hepatitis B virus S mutants in liver transplant recipients who were reinfected despite hepatitis B immune globulin prophylaxis. Hepatology. 1998;27:213-222.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 266]  [Cited by in RCA: 271]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
20.  Ogura Y, Kurosaki M, Asahina Y, Enomoto N, Marumo F, Sato C. Prevalence and significance of naturally occurring mutations in the surface and polymerase genes of hepatitis B virus. J Infect Dis. 1999;180:1444-1451.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 63]  [Cited by in RCA: 67]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
21.  Hou J, Karayiannis P, Waters J, Luo K, Liang C, Thomas HC. A unique insertion in the S gene of surface antigen--negative hepatitis B virus Chinese carriers. Hepatology. 1995;21:273-278.  [PubMed]  [DOI]  [Cited in This Article: ]
22.  Chen HB, Fang DX, Li FQ, Jing HY, Tan WG, Li SQ. A novel hepatitis B virus mutant with A-to-G at nt551 in the surface antigen gene. World J Gastroenterol. 2003;9:304-308.  [PubMed]  [DOI]  [Cited in This Article: ]
23.  Weinberger KM, Zoulek G, Bauer T, Böhm S, Jilg W. A novel deletion mutant of hepatitis B virus surface antigen. J Med Virol. 1999;58:105-110.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
24.  Mehdi H, Yang X, Peeples ME. An altered form of apolipoprotein H binds hepatitis B virus surface antigen most efficiently. Virology. 1996;217:58-66.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 19]  [Cited by in RCA: 23]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
25.  Neurath AR, Seto B, Strick N. Antibodies to synthetic peptides from the preS1 region of the hepatitis B virus (HBV) envelope (env) protein are virus-neutralizing and protective. Vaccine. 1989;7:234-236.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 138]  [Cited by in RCA: 142]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
26.  Laub O, Rall LB, Truett M, Shaul Y, Standring DN, Valenzuela P, Rutter WJ. Synthesis of hepatitis B surface antigen in mammalian cells: expression of the entire gene and the coding region. J Virol. 1983;48:271-280.  [PubMed]  [DOI]  [Cited in This Article: ]
27.  Bruss V, Ganem D. Mutational analysis of hepatitis B surface antigen particle assembly and secretion. J Virol. 1991;65:3813-3820.  [PubMed]  [DOI]  [Cited in This Article: ]
28.  Dong J, Cheng J, Wang Q, Wang G, Shi S, Liu Y, Xia X, Li L, Zhang G, Si C. [Quasispecies and variations of hepatitis B virus: core promotor region as an example]. Zhonghua Shiyan He Linchuang Bingduxue Zazhi. 2002;16:264-266.  [PubMed]  [DOI]  [Cited in This Article: ]
29.  Mathet VL, Feld M, Espínola L, Sánchez DO, Ruiz V, Mandó O, Carballal G, Quarleri JF, D'Mello F, Howard CR. Hepatitis B virus S gene mutants in a patient with chronic active hepatitis with circulating Anti-HBs antibodies. J Med Virol. 2003;69:18-26.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 35]  [Cited by in RCA: 41]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
30.  Ngui SL, Teo CG. Hepatitis B virus genomic heterogeneity: variation between quasispecies may confound molecular epidemiological analyses of transmission incidents. J Viral Hepat. 1997;4:309-315.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 23]  [Cited by in RCA: 31]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
31.  Torresi J. The virological and clinical significance of mutations in the overlapping envelope and polymerase genes of hepatitis B virus. J Clin Virol. 2002;25:97-106.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 137]  [Cited by in RCA: 141]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]