A study of recombinant protective H. pylori antigens

Abstract

AIM: To construct a recombinant vector which can express M_r26000 outer membrane protein (OMP) from Helicobacter pylori (H. pylori), and to obtain the vaccine protecting against H. pylori infection and a diagnostic reagent kit quickly detecting H. pylori infection.

METHODS: The gene encoding the structural M_r26000 outer membrane protein of H. pylori was amplified from H. pylori chromosomal DNA by PCR, and inserted in the prokaryotic expression vector pET32a(+), which was transformed into the Top10 E. coli strain. Recombinant vector was selected, identified and transformed into BL-21(DE3) E. coli strain. The recombinant fusion proteins were expressed. The antigenicity of recombinant protein was studied by ELISA or immunoblotting and immunized Balb/c mice.

RESULTS: The gene of M_r26000 OMP was amplified to be 594 base pairs, 1.1% of the cloned genes was mutated and 1.51% of amino acid residues was changed, but there was homogeneity between them. The recombinant fusion protein encoded objective polypeptides of 198 amino acid residues, corresponding to calculated molecular masses of M_r26000. The level of soluble expression products was about 38.96% of the total cell protein. After purification by Ni-NTA agarose resin columniation, the purity of objective protein became about 90%. The ELISA results showed that recombinant fusion protein could be recognized by patient serum infected with H. pylori and rabbit serum immunized with the recombinant protein. Furthermore, Balb/c mice immunized with the recombinant protein were protected against H. pylori infection.

CONCLUSION: M_r26000 OMP may be a candidate vaccine preventing H. pylori infection.

Key Words: $[Keywords]

INTRODUCTION

Helicobacter pylori (H. pylori) is a microaerophilic, spiral and gram-negative bacillus first isolated from human gastric antral epithelium in 1982. It is recognized as a human-specific gastric pathogen that colonizes the stomachs of at least half of the world's population[1]. Most infected individuals are asymptomatic. However, in some subjects, the infection is associated with the development of peptic ulcer, gastric adenocarcinoma, mucosa-associated lymphoid tissue (MALT) lymphoma and primary gastric non-Hodgkin's lymphoma[2-11]. Furthermore, this organism was recently categorized as a class I carcinoma by the World Health Organization[12], and direct evidence of carcinogenesis was recently demonstrated in an animal model[13,14]. Immunization against the bacterium represents a cost-effective strategy to reduce the incidence of global gastric cancer and would also have a major impact on H. pylori -peptic ulcer disease[15]. The selection of antigenic targets is critical in the design of an Hp vaccine. To date, this area is scarcely touched upon. The majority of studies focused on the urease enzyme, heat shock protein, VacA, and so on[1,16-19], but not M_r26000 outer membrane proteins. So, in this study, the recombinant plasmid of H. pylori M_r26000 outer membrane protein genes was constructed, and expressed for development of H. pylori vaccine.

MATERIALS AND METHODS

Materials

A well-characterized strain, H. pylori, was afforded by the Department of Microbiology, Chongqing University of Medical Sciences. Top10, BL21 E. coli strains and pET32a(+) plasmid were presented by the Institute of Viral Hepatitis of Chongqing University of Medical Sciences. Restriction enzymes (Hind III, BamH I) and T₄ DNA ligase were purchased from Promega, Tag DNA polymerase was produced by immunology Department of the former Beijing Medical University. Isopropyl-β-D-thiogalactopyranoside (IPTG), dNTP and oligonucleotide primers were obtained from Sigma Chemical Co. and so on.

Cloning of Hp M_r26000 OMP gene

Oligonucleotide primers were designed to amplify H. pylori open reading frame (ORFs) of M_r26000 outer membrane protein based on the published genome sequence[20]. The primers were designed with a BamH I site incorporated into the 5’end and a Hind III site at the 3’end as follows (5'-3'): GCGGATCCATGTTAGTTACAAAACTTGCC (forward) and AAGCTTAATGGAATTTTCTTT (reverse). Genomic DNA prepared from Chongqing H. pylori strains was used as the template in the PCR. The PCR cycle consisted of 30 cycles of denaturation at 94 °C for 60 s, annealing at 58 °C for 45 s, with an extension step at 72 °C for 90 s. Products were visualized on 10 g•L⁻¹ agarose gel and purified using a PCR purification kit. After digestion with the restriction enzymes BamH I and Hind III simultaneously, the purified products were cloned into the compatible sites of the expression vectors pET32a(+) using T₄ DNA ligase at a molar ratio of 4∶1 at 4 °C overnight.

Fifty μL Top10 incubated at 37 °C overnight was added into 2 mL Luria-Bertani broths and routinely grew at 37 °C, and shaken at 300 r•min^-1 for 4 h. When optical density at 600 nm was 0.5, it was ultracentrifuged at 10000 r•min^-1 at room temperature (RT) for 2 min. The resulting deposits were suspended with 100 mmol•L⁻¹ CaCL₂ 150 μL and incubated at 0 °C for 2 h. Ten μL connected products (aboved) was resuspended and incubated at 0 °C for 30 min, at 42 °C for 2 min and at 0 °C for 2 min respectively. At last, it was incubated at 37 °C at 180 r·min^-1 for 30 min after the addition of 1 mL LB broth, 200 μL was collected and spred onto an LB plate containing 100 mg•L⁻¹ ampicillin as the selectable marker and incubated at 37 °C overnight.

Extraction and expression of recombinant plasmid

The next day, the single cloned bacterial drop was selected, and cultured in 2 mL LB broth containing 100 mg•L⁻¹ ampicillin at 37 °C overnight at 300 r•min^-1, then recombinant plasmids were extracted and screened with plasmid extraction kit according to the manufacturer's instruction, in the meantime, identified by PCR and restriction enzyme digestion. The recombinant plasmids were selected and transformed into competent BL21(DE3) E. coli strains using standard procedures. BL21 E. coli strains containing recombinant plasmid were grown until mid-log phase (optical density at 600 nm = 0.5 to 1.0), and expression of the fusion proteins was induced by addition of 0.5-4.0 mmol•L⁻¹ IPTG for 4 h. Following induction, the bacteria were harvested by ultracentrifugation at 12000 r•min^-1, resuspended in protein-buffer and seethed for 5 min. Total protein was electrophoresed on SDS-PAGE gel and stained with coomassie.

Immunoblotting analysis

Briefly, the M_r26000 OMP was purified using Ni-NTA agarose resin after bacteria were cultured and broken down cy microwave with the energy of 600 W × 35% for 40 min, ultracentrifuged (10000 g, 15 min, 4 °C), and then quantified. H. pylori M_r26000 outer membrane protein-specific antibody was produced following subcutaneous immunization of the New Zealand rabbits, while age-matched control rabbits were immunized with PBS as described previously[17]. Serum antibody specificity was determined by ELISA or immunoblotting following electrophoretic transfer of SDS-PAGE-separated (150 g•L⁻¹ acrylamide)H. pylori M_r26000 outer membrane protein to 0.45 μm pore size PVDF membrane. After a 30 min wash in Tris-saline blotting buffer, antigen-impregated PVDF strips were incubated with the rabbit sera for 2 h at RT. After washing, bound rabbit antibodies were detected by incubation of the strips in alkaline phosphatase-conjugated goat anti-rabbit IgG antibody for 1 h at RT.

Prophylactic immunization

Six- to eight-week-old mice were immunized three times by subcutaneous immunization using emulsified M_r26000 OMP with Freund's adjuvant at intervals of 1, 14 and 21 d respectively, to produce antibody responded to M_r26000 outer membrane protein. The dose consisted of 1 mL (100 mg•L⁻¹) of purified M_r26000 OMP and 1 mL complete Freund's adjuvant. Thereafter, the dose consisted of 0.5 mL OMP and 0.5 mL incomplement Freund's adjuvant. Age-matched control mice were immunized with PBS. The antibody titers in immunized mice were monitored by ELISA with purified fusion protein. Mice were challenged with a single dose of 10⁸H. pylori organisms 7 d after the last immunization. Twenty-eight days after challenge, the mice were killed by cervical dislocation. The stomach of each animal was removed, bisected longitudinally, and pinned out. Full-thickness tissue was taken from the antrum-body area of one-half of each stomach and placed into 0.2 mL of urease test medium. Urease activity in the sample, identified by a distinctive color change in the medium, was assessed after 24 h incubation at RT. The remainder of the stomach was fixed in 100 mL•L⁻¹ buffered formalin and embedded in paraffin. Longitudinal sections, stained with a modified May-Grunwald Giemsa stain, were scanned by full length under light microscopy. Mice were considered protected or not according to the previously report[17].

Statistical analysis

The Student test was used to evaluate the presence or absence of experimental infection in test and control animals as well as the anti- M_r26000 outer membrane protein response to immunization. P values < 0.05 were considered as statistically significant.

RESULTS

PCR amplification of H. pylori M_r26000 OMP gene

According to the literature, the gene encoding the M_r26000 outer membrane protein, was amplified by PCR with Chongqing H. pylori strain's chromosomal DNA as the templates. The cloning products were electrophoresed and visualized on 10 g•L⁻¹agarose gel (Figure 1). It revealed that M_r26000 OMP DNA fragment amplified by PCR contained a gene of approximately 594 nucleotides, which was compatible with the previous reports[21].

Figure 1 Ten g•L⁻¹ agarose gel electrophoreses of M_r26000 OMP DNA fragment amplified by PCR from Helicobacter pylori. Lane1: Nucleotide marker; Lane2-4: PCR products; Lane 5: Negative control.

Identification of recombinant plasmid by restriction enzyme digestion

The recombinant plasmids pET32a(+) were all digested by Hind III or BamH I, and by Hind III and BamH I simultaneously, then digestive products were visualized on 10 g•L⁻¹ agarose gel eletrophoreses (Figure 2). It demonstrated that recombinant plasmid contained the objective gene.

Figure 2 The identification of recombinant plasmid by restriction enzyme digestion. Lane1: Nucleotide marker; Lane2: pET32a(+)/Hind III; Lane3: pET32a(+)/Hind III, BamH I; Lane4: Recombinant plasmid/Hind III; Lane5: Recombinant plasmid/Hind III, BamH I.

Sequence analysis of cloned M_r26000 OMP nucleotide

The nucleotide sequence of the cloned genes inserted in pET32a(+) was analyzed by automated sequencing across the cloning junction, using the universal primer T₇. The results were: the cloned genes contained 594 nucleotides with a promoter and a start codon coding a putative protein of 198 amino acid residues with a calculated molecular mass of M_r26000. As compared with previously reports, 1.1% of the cloned genes were mutated, and 1.51% amino acid residues were changed. The homogeneity was about 98% between them. The cloned gene and mutative protein sequences were published in GenBank (AY 033499).

Analysis of the recombinant fusion protein

Following recombinant vector transformed into BL21 E. coli strains, the fusion protein was amply expressed. Its molecular mass was M_r46000 by 150 g•L⁻¹ SDS-PAGE gel analysis (the expression of the pET32a(+) vector, M_r20000). After the recombinant bacteria broken down by microwave and ultracentrifuged (10000 r•min^-1, 15 min, 4 °C), the level of soluble fusion protein in the supernatant was about 38.96% of total cell protein. After purification by Ni-NTA agarose resin columniation, the purity of objective protein was about 90% (Figure 3).

Figure 3 150 g•L⁻¹ SDS-PAGE analysis of the fusion protein expressed in BL21(DE3). Lane1: Molecular weight marker; 2Lane: BL21 after 4 h induction with IPTG; Lane3-9: BL21/recombinant vector expression after 4 h induction with 0.5, 1, 1.5, 2, 2.5, 3, 4 mmol•L⁻¹ IPTG respectively; Lane10: BL21/pET32a(+) vector expression after 4 h induction with IPTG.

Antigenicity study of recombinant fusion protein

Sera were obtained from persons infected and not infected with H. pylori respectively. The recombinant fusion protein was recognized by the H. pylori positive sera, not recognized by the H. pylori negative sera, while the expressed protein of BL21/pET32a(+) not recognized by the H. pylori positive sera; the recombinant fusion protein was also recognized by the rabbit sera immunized with M_r26000 OMP, however the expressed protein of BL21/pET32a(+) not recognized by the rabbit sera immunized with M_r26000 OMP.

Prophylactic efficacy with H. pylori M_r26000 OMP

Subcutaneous immunization with H. pylori OMP and FA (Freund's adjuvant) conferred immune protection against H. pylori challenge in 19 (95%) of 20 mice. In contrast, 15 (100%) of 15 naive control animals were infected with H. pylori. These differences were statistically significant (P < 0.05). The protection from infectious challenge was correlated with serum antibody reactivity to M_r26000 OMP by immunoblotting. Similar reactivity was absent in the sera collected from same animals prior to immunization, while sera from mice sham immunized with PBS and FA failed to display similar immune responsiveness.

DISCUSSION

The outer membrane is a continuous structure on the surface of gram-negative bacteria and an asymmetric bilayer with phospholipids in the inner monolayer and the bulky glycolipid lipopolysaccharide (LPS) in the outer monolayer, in bacterial pathogens, has bilateral particular significance as a potential target for protective immunity and avoiding the host's immune system. Outer membrane vaccines have been used with considerable success to induce protection against a number of organisms, including H. pylori the heat shock protein, urease A, B and so on. M_r26000 OMP is a low molecular mass Hor protein belonging to family I of H. pylori [20]. An earlier study showed that it was commonly expressed in all H. pylori strains examined so far. Furthermore, no cross-reaction is shown when antibodies (polyclonal and monoclonal) to H. pylori low-molecular outer membrane protein are used to immunoscreen closely related species of helicobacter, campylobacter, or a diverse range of other bacteria. H. pylori low molecular outer membrane protein is unique.

In our study, 1.1% of the cloned genes was mutated, 1.51% of amino acid residues was changed as compared with other reports[20]. The reasons of difference might be summarized as follows: (1) H. pylori chromosomal DNA as templates were different; (2) there is heterogeneity among strains; and (3) H. pylori was provided with the ability of transformation, which could lead to H. pylori variated and genome reseted[22]. But there was homogeneity between them. The purified recombinant M_r26000 OMP antigen could be recognized by the sera of patients infected with H. pylori and rabbit sera immunized with the recombinant protein. Moreover, in animal model, Balb/c mice immunized with the recombinant fusion protein were protected against H. pylori infection. These were consistent with previous reports[23-26]. While being an immunogenic marker, M_r26000 OMP showed a high sensitivity and specificity[27]. Moreover, a significant association was found between the serologic response to M_r26000 antigen and malignant outcome of H. pylori infection[28-31]. So the serum test for detecting antibody with low molecular weight proteins of H. pylori could be useful for identifying H. pylori-infected patients at risk of peptic ulcer or malignancy. The results showed that M_r26000 OMP is not only an immunogenic marker for detecting Helicobacter pylori infection and gastric carcinoma, but also a true vaccine candidate.

In addition to constructing the recombinant vector, we also tried to seek live carriers, because antigen delivery systems can influence the immune response qualitatively as well as quantitatively. Immunization via the mucosal route offers the advantage that it has the potential to stimulate both mucosal immunity and systemic immunity. It is simple, safe and can be used for the immunization of large population groups. Another advantage is the existence of the common mucosal immune system which induced protective immune responses at one mucosal site to be expressed at another[32]. So live carriers on oral route are ideal vaccine delivery systems and are being increasingly used to express large amounts of protective recombinant antigens. We are investigating live carriers to provide a mucosal vaccine vector to deliver M_r26000 OMP to antigen-presenting cells on the mucosal surface.