Xie Q, Liao D, Zhou XQ, Qian SB, Cheng SS. Transduction of primary rat hepatocytes with bicistronic retroviral vector. World J Gastroenterol 2000; 6(5): 725-729 [PMID: 11819682 DOI: 10.3748/wjg.v6.i5.725]
Corresponding Author of This Article
Qing Xie, Department of Infectious disease, Ruijin Hospital, Shanghai Second Medical University, 197 Ruijin 2nd Road, Shanghai 200025, China
Article-Type of This Article
Brief Reports
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Qing Xie, Dan Liao, Xia Qiu Zhou, Department of Infectious Disease, Ruijin Hospital, Shanghai Second Medical University, Shanghai 200025, China
Shu Bing Qian, Shi Shu Cheng, Human Genetic Therapy Research Center, Shanghai Second Medical University, Shanghai 200025, China
Qing Xie, graduated from Shanghai Second Medical University in 1988, now associate professor of infectious diseases, engaged in the researches of therapy and mechanisms of viral hepatitis, having 20 papers published.
ORCID number: $[AuthorORCIDs]
Author contributions: All authors contributed equally to the work.
Supported by the grant of National Natural Science Foundation of China, No. 39600129
Correspondence to: Qing Xie, Department of Infectious disease, Ruijin Hospital, Shanghai Second Medical University, 197 Ruijin 2nd Road, Shanghai 200025, China
Telephone: 0086-21-64311242 Fax: 0086-21-64451757
Received: February 22, 2000 Revised: February 28, 2000 Accepted: March 1, 2000 Published online: October 15, 2000
Hepatocellular transplantation (HCT) could provide a therapeutic alternative to orthotopic liver transplantation (OLT) in the treatment of hepatic metabolic defects and experimental hepatic failure[1-4]. Under appropriate conditions, the engrafted liver cells can continue to express liver-specific functions for an indefinite period of time. The major limitation of many animal studies in HCT is that, since the donor hepatocytes are often indistinguishable from those of the host, it has often been difficult to demonstrate a clear correlation between engraftment and the therapeutic effect. In order to verify engraftment dependent on the therapeutic response, a recombinant retroviral vector carrying marker genes is used to label the donor hepatocytes[5,6]. The vector is capable of transducing hepatocytes, integrating gene stably into the genome and directing expression. Efficient retroviral-mediated gene transfer has introduced the possibility of targeting genetic markers to hepatic cells and somatic gene therapy for liver diseases[7-11]. Stable integration and expression of retroviral genes is dependent upon active division of the infected cell[9-13]. Although hepatocytes maintain growth potential in vivo and are capable of substantial regeneration following partial hepatectomy, their ability to grow in culture is quite limited.
In the present study, we explored the optimal culture system for hepatocyte proliferation and the potential for retroviral-mediated gene transfer into primary hepatocytes. We successfully demostrated the efficient and stable transduction of primary culture of adult rat hepatocyte by replication of defective retrovirus carrying β-gal gene and NeoR gene.
MATERIALS AND METHODS
Animals
Male Sprague-Dawley rats weighing 140 g-200 g were provided by Experimental Animal Center of Shanghai Second Medical University.
Sources
Hepatocyte-specific collagenase and culture medium were purchased from GIBCO-BRL (Gaithersburg, MD). Insulin, dexamethasone, transferrin, polybrene and epidemal growth factor (EGF) were Sigma Chemicals products (St. Louis, MO). 4CL-5Bt-3indolyl-β-galactoside (X-Gal) was purchased from Hua Mei Biotech Co. 3H-TdR was purchased from Neucleic Energy Institute. Tissue/cell DNA extract kit was purchased from Shanghai Hua Shun Biotechnical Limited Co. Culture plastic dishes were Nunclon Co product.
Isolation and culture of hepatocytes
Rat hepatocytes were prepared by the modified procedure of Seglen with a two-step collagenase perfusion combined with 49.5% Ficoll centrifugation[14-15]. The dissociated cells were suspended in hormonally defined medium: M199 containing 10% fetal calf serum (FCS), 10-8 M insulin, 10-6 M dexamethasone and 5 mg/L transferrin. They were seeded at a density of 3 × 104 cells/cm2 on a 35 mm tissue culture plastic dishes, and grown at 37 °C in a 5% CO2 environment. The medium was changed 4 h after seeding, and replaced by different culture mediums: group A with M199 containing 5% FCS, 10-8 M insulin, 10-6 M dexamethasone, 5 mg/L transferrin; group B with M199 containing 5% FCS, 10-8 M insulin, 10-6 M dexamethasone, 5 mg/L transferrin plus 10 μg/L EGF. The medium was renewed every 24 h thereafter.
Production of retroviral infected hepatocytes
PA317 cell line producing simutaneously the recombinant retrovirus PGCEN/β-gal expressing β-galactosidase gene (LacZ) and neomycin-resistance gene (NeoR) was a gift from Prof. Cheng Shishu (Human Genetic Therapy Research Center, SSMU). These two genes were controlled by the same promotor. Its structure is shown in Figure 1. The producer PA317 was maintained in DMEM supplemented with 10% FCS. Virus-containing medium was harvested from the producers after 16-20 h, filtered through a 0.45 mm filter unit, and used for infecting the cultured hepatocytes. The viral titer ranged from 1 to 2 × 106 blue colony-forming unit (bcfu)/mL, when tested with NIH 3T3 cells.
Figure 1 Structure of bicistronic retroviral vector PGCEN/β-gal.
Arrow below vector indicates initiated site of transcription.
Hepatocytes in group B were grown for 1 to 5 d. Three dishes were selected randomly at 24, 48, 72, 96 and 120 h. The medium was removed and rinsed with PBS. The cells were incubated for 6 h with 1 mL of viral supernatant plus 8 µg of polybrene per mL. Then the viral supernatant was cultured by replacing with fresh medium. Repeat the infection once a day for 24 to 96 h.
Detection of LacZ expression by X-Gal staining
Cells infected with PGCEN/β-gal virus constitutively produced high levels of cytoplasmic β-galactosidase. In order to detect β-gal activity, infected hepatocytes were washed in phosphate-buffered saline (PBS) containing Ca2+/Mg2+, and fixed 5 min in 4% formaldehyde in PBS pH7.4, rinsed again with PBS, then stained at 37 °C with X-Gal (1 g/L) for 2-24 h, as previously described[16]. Blue precipitate in infected cells were seen under microscope. Areas of X-gal-stained rat primary hepatocyte culture dishes were quantitated for transducted cells using VIDAS computer-assisted image analysis. Three fields were randomly chosen and gene transductive efficiency was evaluated as follows: Gene transduction efficiency (%) = Blue-stained cells areas/Total cells areas × 100%
Measurement of hepatocyte DNA synthesis
In this assay, cells were cultured in absence or in presence of EGF for various durations. DNA synthesis was measured by 3H-thymidine incorporation. Cultures in 35 mm-dish were treated with 3H-thymidine (1 µCi/mL) for 5 h before harvest. Cells were detached by trypsinization at 37 °C, washed with PBS twice and counted. The cells were lysed with distill water. DNA were precipitated with 5% trichloroacetic acid and absolute ethanol, and collected on glass fiber-filters. DNA were then assayed for radioactivity in a liquid scintillation counter. 3H-thymidine incorporation in DNA was expressed as cmp/105 cells.
Glucose-6-phosphatase activity by cytoche-mical procedure
Glucose-6-phosphatase activity was detected by the lead phosphate enzyme cytochemical procedure[17]. Characteristic brown/black cytoplasmic staining was seen if cultured hepatocytes expressed glucose-6-phosphatase.
Detection of NeoR expression by molecular method
DNA from cultured cells was isolated by proteinase K digestion in 10 mM Tris-hydrochloric acid (pH8.0) and 1% sodium dodecyl sulfate at 55 °C for 2 h, followed by phenol extraction and ethanol precipitation. According to the reference[10], the primer was synthesized by Bioengineering Research Center in Shanghai of Chinese Academy of Science. The nucleotide sequences of NeoR primers were as follows: Sense 5’CAAGATGGATTGCACGCAGG3’, antisense 5’CCCGCTCAGAAGAACTCGTC3’ 790 bp.
The total 50 µL PCR reaction system consisted of 10 × amplification buffer solution 5 µL, 2.5 mmol/L DNTP 4 µL, 25 mmol/L MgCl2 3 µL, 25 µmol/L primer 2 µL, reverse transcription product 10 µL, and added ddH2O up to 50 µL mixing together, and added to Taq DNA polymerase 0.5 µL after denatured for 5 min. The amplification condition was predenatured at 94 °C for 1 min, 60 °C for 1 min, 72 °C for 1.5 min altogethe for 30 cycles, finally, extension at 72 °C for 10 min.
Ten µL PCR product ran in agarose gel (1%, containing ethdium bromide 0.5 mg/L) electrophoresis at 100 V for 40 min and photographed under ultraviolet lamp.
RESULTS
Isolation and culture of hepatocytes
Each rat liver weighing 150-200 g was perfused by modified two-step collagenase via portal vein. The yield of hepatocytes was 1-2 × 108 cells. The viability was over 95%. The cells were seeded at densities of 3 × 104 cells/cm2 on 35 mm dish. They became attached to the dishes in 3-4 h. Hepatocytes became polygonal epithelium-like structure. The majority of cells were mononucleated; some were bi-or multi-nucleated. The membranes were clearly seen. Hepatocytes started to divide in aggregates a few hours after attachment and became confluent within 3-4 d (Figure 2).
Figure 2 Morphology of hepatocytes in culture.
× 100 Hepatocytes became polygonal epitheliumlike structure. The majority of cells were mononucleated; Some cells were bi-or multi-nucleated. The membranes were visible. Hepatocytes became confluent at 4 d postplating.
Influence of EGF on hepatocytes proliferation in vitro
In order to compare the DNA synthesis in hepatocytes, the level of 3H-thymidine incorporation in the cell layer was measured in EGF stimulated and unstimulated primary hepatocyte cultures. After the addition of 10 μg/L EGF to the cultures, the level of 3H-thymidine incorpor ation began to increase at 48 h of culture, and reached the peak on the 5th day. Fifty-nine-folds increase of 3H-TdR incorporation was found in EGF-treated cultures compared to conventional cultures. The differences between the two culture conditions were statistically significant at 48, 72, 96 and 120 hrs (P < 0.01). The addition of 10 μg/L EGF to the culture increased 50 times incorporation at 120 h as compared with that at 24 h. There was also significant difference between the two time points (Table 1).
Table 1 Effect of EGF on DNA synthesis of rat hepatocyte by 3H-TdR incorporation [cpm/(105 cell·h)].
Retrovirus transduction in cultured hepatocytes and detection of LacZ expression
Triplicate cultures of infected hepatocytes were analyzed in situ for retrovirus transduction and expression by cytochemical staining for β-galactosidase. Cells that expressed viral-directed β-galactosidase was exhibited specifically by this procedure. Although the proliferation of rat primary hepatocyte was limited, the highest rate of infection was obtained by adding EGF. The rate of infection was gradually increased on the first 4 d, reached the peak on the 4th day of infection, but transduction efficiency dropped gradually in cultures on the 5th day of infection. The transduction efficiency in repeated infection group was about 22% (Figure 3).
Figure 3 Transduction efficiency of hepatocytes by retroviral vector.
Expression of hepatocyte function
We used a liver-specific cytochemical stain to detect the functional hepatocytes. The expression of glucose-6-phosphatase was analyzed in culture at different periods by cytochemical staining. Characteristic brown/ black cytoplasmic staining was seen in > 85% of the cells at 48 h of culture. The activity was still present at a slightly diminished level in > 60% of cells on the 6th day.
PCR detection of NeoR gene
Transduction with PGCEN/β-gal was also assessed by PCR detection of NeoR gene. Analysis of PCR product showed that the amplified product with 790 bp was visualized with ethidium bromide after electrophoresis in transduced rat hepatocytes, while this specific PCR product was absent in nontransduced primary rat hepatocytes (Figure 4).
Figure 4 PCR detection of NeoR in primary rat hepatocytes transduced by PGCEN/β-gal.
A: Size markers (Lambda DNA/EcoR + Hind III Marker) B: Positive template (MN45Li cell lines modified by NeoR gene) C: Primary rat hepatocytes transduced with retroviral vector PGCEN/β-gal D: Nontransduced primary rat hepatocytes E: Water control
DISCUSSION
Two-step collagenase perfusion via portal vein is the conventional method for availability of hepatocytes, reports were available regarding cultured hepatocytes prepared by this method. In our present study a two-step collagenase perfusion in combination with 49.2% ficoll gradient centrifugation was used. This techinique provided a higher yield of viable rat hepatocyte with a minimal nonparenchymal cells. It was helpful to culture hepatocytes in vitro and to perform various studies of hepatocytes, such as establishment of cell bank and retrovirus-mediated gene transfer.
It is generally considered that efficient transduction of retroviral gene is dependent upon active proliferation of infected cells[9-13]. Although hepatocytes maintain growth potential in vivo and are capable of substantial regeneration following partial hepatectomy, the ability of adult hepatocytes to grow in culture without growth factors stimulation is limited[18-25]. In this experiment, with addition of 10 μg/L EGF to the conventional culture, the cells retained their ability to proliferate, and showed excellent hepatocyte morphology. We were able to demonstrate that these cells could divide in short-term culture, and could be infected with recombinant retrovirus.
Liver cell transplantation can support the impaired liver. If the transplanted cells exhibit a growth preponderance and specific liver functions, they will rapidly replace the patient’s hepatocytes. Glucose-6-phosphatase is a well-recognized specific enzyme expressed by the hepatocytes. It can be detected in viable hepatocytes by cytochemical staining. In our experimental system, hepatocytes could be isolated and cultured under conditions that maximized the division of parenchymal cells and prolonged the expression of glucose-6-phosphatase activity more than 10 days. The labelled donor hepatocytes via transducing these cells with a recombinant retroviral vector carrying a marker gene is used for evaluating the fate and function of the transplanted cell in vivo. Our data demonstrate that recombinant retroviruses are efficient tools to transfer marker gene into rat primary hepatocytes. The rat hepatocytes proliferated increasingly under EGF stimulation, 20% of the cells could be transduced. Our experiments of 3H-TdR incorporation corrobrate the observation of Chenoufi et al[25]. We found that the cells had a high DNA synthetic rate that could be increased by adding EGF. In the first four days after plating, efficient transduction correlates positively with the state of proliferation (r = 5.427, P < 0.05). Transduction rate decreased after the fifth day. Thus, our results indicate that the susceptibility to retroviral infection of hepatocytes varies with the ability of the cell proliferation, functional status of hepatocytes such as the level of receptor expression and many other factors[9-13].
Retroviral vector was frequently used in gene therapy[26,27]. Recombinant retroviral vector PGCEN/β-gal used in the present study is an bicistronic retroviral vector expressing β-galactosidase gene and NeoR gene simutaneously, because these two genes were connected by the internal ribosome entry site of encephalomyocarditis virus and controlled by the same promotor[28]. Transduction efficiency was estimated by detection of β-gal gene expression by in situ staining, which was shown clearly and quantitatively. NeoR gene and target gene could be detected in the integrated cells from DNA level by PCR or southern blot[29-30]. PCR method increased the sensitivity of detection, which is helpful in tracing the life span of transplanted cell in vivo[29,30]. One study indicates that primary rat hepatocytes can be efficiently tranduced by a NeoR and β-gal-expressing recombinant retrovirus (PGCEN/β-gal). This approach is now being used to determine the most efficient way of cell transplantation and to investigate the location, life span and function of the transplanted hepatocytes.
Tateno C, Yoshizato K. Long-term cultivation of adult rat hepatocytes that undergo multiple cell divisions and express normal parenchymal phenotypes.Am J Pathol. 1996;148:383-392.
[PubMed] [DOI]
Chenoufi N, Loréal O, Drénou B, Cariou S, Hubert N, Leroyer P, Brissot P, Lescoat G. Iron may induce both DNA synthesis and repair in rat hepatocytes stimulated by EGF/pyruvate.J Hepatol. 1997;26:650-658.
[PubMed] [DOI]
Cao GW, Gao J, Du P, Qi ZT, Kong XT. Construction of retroviral vectors to induce a strong expression of human class I interferon gene in human hepatocellular carcinoma cells in vitro.China Natl J New Gastroenterol. 1997;3:139-142.
[PubMed] [DOI]
Cui L, Cao GW, Wang YH, Tu Y, Meng RG, Gao J, Qiu XF, Wu ZD. Construction of retroviral vector containing HSV tk gene for colorectal carcinoma tissue specific gene therapy.Huaren Xiaohua Zazhi. 1998;6:647-649.
[PubMed] [DOI]
Ledley FD, Adams RM, Soriano HE, Darlington G, Finegold M, Lanford R, Carey D, Lewis D, Baley PA, Rothenberg S. Development of a clinical protocol for hepa tic gene transfer: lessons learned in preclinical studies.Pediatr Res. 1993;33:313-320.
[PubMed] [DOI]