Association and functional study of ATP6V1D and GPHN gene polymorphisms with depression in Chinese population

Table 1 Characteristics of the study population, n (%)

Variables	Controls (n = 509)	Case (n = 555)	P value
Age (years)	50.8 ± 18.6	42.2 ± 17.7	< 0.01
Gender
Male	191 (37.5)	161 (29.0)	0.030
Female	318 (62.5)	394 (71.0)	-
Age of onset (years), mean ± SD	-	37.3 ± 16.7	-
Pulse rate, mean ± SD	87.07 ± 13.4	79.4 ± 12.3	< 0.01
Education
Elementary school	82 (16.1)	36 (6.5)	-
Junior middle school	131 (25.7)	151 (27.2)	-
High school	154 (30.3)	160 (28.8)	-
Junior college and above	142 (27.9)	208 (37.5)	-
Profession
Student	76 (14.9)	154 (27.7)	-
Mental labor	179 (35.2)	194 (35.0)	-
Manual labor	130 (25.5)	71 (12.8)	-
Retired or unemployed	124 (24.4)	136 (24.5)	-
Depressive episode
Severe	0 (0)	277 (49.9)	-
Mild/moderate	0 (0)	278 (50.1)	-
No	509 (100)	0 (0)	-
Family history
Positive	0 (0)	97 (17.5)	-
Negative	509 (100)	458 (82.5)	-
Suicide attempt
Yes	0 (0)	314 (56.6)	-
No	509 (100)	241 (43.4)	-
First-episode
Yes	0 (0)	278 (50.1)	-
No	509 (100)	277 (49.9)	-

Table 2 Primers sequences used in this study

Description	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
rs8020095	CACAGATAGACAGTGAGGAATGCTA	CATGGATGAAGGTGTGTTTGTATGT
rs10144417	CCAGAGCCGACTTCTTCAATCACAG	GTCCTATGTCTTTCTCGCGCCTTGA
rs2031564	GGCGGAAGAAAAGATGGAATTCTCA	TGTGTTCCAGAGGCATCGTTGTTCG
rs8016024
rs3759755	ACAGGAAAGGTGGAACAGAAATACT	TACCTACCATTTGTCATGCAAAATA

Table 3 Association of the rs3759755, rs10144417, rs2031564, rs8020095 and rs8016024 polymorphisms with depression risk, n (%)

Models	Polymorphisms	Controls (n = 509)	Patients (n = 555)	Adjusted OR (95%CI)1	P value
rs10144417
Codominant	A/A	151 (29.7)	195 (35.1)	1.00	-
	A/G	270 (53.0)	260 (46.9)	0.71 (0.53-0.94)	0.015
	G/G	88 (17.3)	100 (18.0)	0.81 (0.56-1.18)	0.270
Dominant	A/A	151 (29.7)	195 (35.1)	1.00	-
	A/G-G/G	358 (70.3)	360 (64.9)	0.73 (0.56-0.95)	0.021
Recessive	A/A-A/G	421 (82.7)	455 (82.0)	1.00	-
	G/G	109 (17.3)	100 (18.0)	1.01 (0.73-1.40)	0.940
Allele	A	572 (56.2)	650 (58.6)	1.00	-
	G	446 (43.8)	460 (41.4)	0.87 (0.73-1.04)	0.130
rs2031564
Codominant	G/G	126 (24.8)	148 (26.7)	1.00	-
	G/A	263 (51.7)	270 (48.6)	0.82 (0.61-1.11)	0.200
	A/A	120 (23.6)	137 (24.7)	1.15 (0.80-1.64)	0.450
Dominant	G/G	126 (24.8)	148 (26.7)	1.00	-
	G/A-G/G	383 (75.2)	407 (73.3)	0.84 (0.63-1.12)	0.230
Allele	A	572 (56.0)	650 (59.0)	1.00	-
	G	446 (44.0)	460 (41.0)	1.06 (0.89-1.27)	0.510
rs3759755
Codominant	A/A	155 (30.5)	196 (35.3)	1.00	-
	A/C	270 (53.0)	259 (46.7)	0.71 (0.54-0.95)	0.081
	C/C	84 (16.5)	100 (18.0)	0.88 (0.60-1.27)	0.490
Dominant	A/A	155 (30.5)	196 (35.3)	1.00	-
	A/C-C/C	354 (69.5)	359 (64.7)	0.75 (0.58-0.98)	0.036
Recessive	A/A-A/C	425 (83.5)	455 (82.0)	1.00	-
	C/C	84 (16.5)	100 (18.0)	1.08 (0.78-1.50)	0.650
Allele	A	580 (57.0)	651 (58.6)	1.00	-
	C	438 (43.0)	459 (41.4)	0.90 (0.75-1.07)	0.240
rs8016024
Codominant	T/T	131 (25.7)	158 (28.5)	1.00	-
	T/C	260 (51.1)	264 (47.6)	0.79 (0.58-1.06)	0.110
	C/C	118 (23.2)	133 (24.0)	0.83 (0.58-1.19)	0.310
Dominant	T/T	131 (25.7)	158 (28.5)	1.00	-
	T/C-C/C	378 (74.3)	397 (71.5)	0.80 (0.61-1.06)	0.120
Allele	T	522 (51.0)	580 (52.0)	1.00	-
	C	496 (49.0)	530 (48.0)	0.91 (0.77-1.09)	0.320
rs8020095
Codominant	G/G	125 (24.6)	164 (29.5)	1.00	-
	G/A	274 (53.8)	285 (51.4)	0.72 (0.53-0.97)	0.028
	A/A	110 (21.6)	106 (19.1)	0.66 (0.45-0.95)	0.025
Dominant	G/G	125 (24.6)	164 (29.5)	1.00	-
	G/A-A/A	384 (75.4)	391 (70.5)	0.70 (0.53-0.93)	0.013
Recessive	G/G-G/A	399 (78.4)	449 (80.9)	1.00	-
	A/A	110 (21.6)	106 (19.1)	0.82 (0.60-1.12)	0.210
Allele	A	494 (48.5)	497 (44.8)	1.00	-
	G	524 (51.5)	613 (55.2)	1.23 (1.03-1.46)	0.023

¹Odds ratio was adjusted by age and gender.

OR: Odds ratio; CI: Confidence interval.

Table 4 Stratified analyses of the rs3759755, rs10144417, rs2031564, rs8020095 and rs8016024 polymorphisms with depression risk, n (%)

Variables	Frequency		OR (95%CI)1	P value
rs8020095
Depressive episode	Severe	Mild	-	-
G/G	81 (29.1)	83 (30.0)	1.00 (Ref)	-
G/A-A/A	197 (70.9)	194 (70.0)	0.89 (0.61-1.29)	0.54
Suicide attempt	Yes	No	-	-
G/G	81 (25.7)	83 (34.6)	1.00 (Ref)	-
G/A-A/A	234 (74.3)	15 (65.4)	0.73 (0.50-1.07)	0.11
First-episode patient	Yes	No	-	-
G/G	80 (28.6)	84 (30.7)	1.00 (Ref)	-
G/A-A/A	200 (71.4)	190 (69.3)	1.00 (0.69-1.46)	1.00
Family history	Yes	No	-	-
G/G	28 (27.7)	136 (30.0)	1.00 (Ref)	-
G/A-A/A	73 (72.3)	318 (70.0)	0.95 (0.58-1.54)	0.82
rs10144417
Depressive episode	Severe	Mild	-	-
A/A	97 (34.9)	98 (35.4)	1.00 (Ref)	-
A/G-G/G	181 (65.1)	179 (64.6)	0.94 (0.66-1.34)	0.75
Suicide attempt	Yes	No	-	-
A/A	104 (33.0)	91 (37.9)	1.00 (Ref)	-
A/G-G/G	211 (67.0)	149 (62.1)	0.85 (0.59-1.23)	0.39
First-episode patient	Yes	No	-	-
A/A	99 (35.4)	96 (34.9)	1.00 (Ref)	-
A/G-G/G	181 (64.6)	179 (65.1)	1.08 (0.75-1.54)	0.67
Family history	Yes	No	-	-
A/A	32 (31.7)	163 (35.9)	1.00 (Ref)	-
A/G-G/G	69 (68.3)	291 (64.1)	0.85 (0.54-1.36)	0.50

¹Odds ratio was adjusted by age and gender.

OR: Odds ratio; CI: Confidence interval.

Table 5 Haplotype analysis of the rs10144417, rs2031564, rs3759755, rs8016024 and rs8020095 with the depression, n (%)

Haplotype	Patients	Control	OR (95%CI)	P value (dimensionless)
	2n = 1110 (%)	2n = 1018 (%)
AGATG	536 (48.3)	468 (46.0)	1.000	-
GACCA	437 (39.4)	421 (41.4)	0.906 (0.755-1.008)	0.291
AAACG	52 (4.7)	33 (3.2)	1.376 (0.874-2.165)	0.166
AGATA	28 (2.5)	43 (4.2)	0.569 (0.348-0.930)	0.023

Haploid types with a population frequency lower than 0.02 were excluded from the study. OR: Odds ratio; CI: Confidence interval.