Copyright
©2014 Baishideng Publishing Group Co.
World J Cardiol. Apr 26, 2014; 6(4): 183-195
Published online Apr 26, 2014. doi: 10.4330/wjc.v6.i4.183
Published online Apr 26, 2014. doi: 10.4330/wjc.v6.i4.183
Table 1 Baseline characteristics of the study population n (%)
Characteristic | Value1 | n3 |
Age, yr | 46.9 ± 15.82 | 498 |
Male | 341 (68.5) | 498 |
Female | 157 (31.5) | 498 |
Molecular findings | ||
B19V-genotype 1 | 286 (57.4) | 498 |
B19V-genotype 2 | 183 (36.7) | 498 |
Endomyocardial biopsy results4 | ||
Acute myocarditis | 25 (5.0) (3.2 × 105 GE/μg)5 | 498 |
Inflammatory cardiomyopathy | 297 (59.6) (709 GE/μg)5 | 498 |
Dilated cardiomyopathy | 176 (35.3) (392 GE/μg)5 | 498 |
Uninflamed control hearts | ||
B19V-detection | 7 (7.7) (84 GE/μg)5 | 91 |
Age (at death), yr | 48.1 ± 20.82 | 91 |
Male | 49 (53.9) | 91 |
Female | 42 (46.1) | 91 |
Table 2 Primer sequences
No | Primer name | Sequences (5’ to 3’) | Position (numbering according M13178) | 1st, 2nd (RT/RFLP)-PCR |
1 | PVB1 | GCTAACTCTGTAACTTGTAC | 3221-3240 | Sense B19V-VP2-PCR (2nd PCR) |
2 | PVB2 | AAATATCTCCATGGGGTTGAG | 3373-3393 | As B19V-VP2-PCR (2nd PCR) |
3 | PVB3 | AGCATGTGGAGTGAGGGGGC | 3191-3210 | Sense B19V-VP2-PCR (1st PCR) |
4 | PVB4 | AAAGCATCAGGAGCTATACTTCC | 3458-3480 | As B19V-VP2-PCR (1st PCR) |
5 | NS-25 | AAATGCGTGGAAGTGTAGCT | 1628-1647 | Sense B19V-NS1-PCR (RT/1st PCR) |
6 | NS-27 | ATGCGTGGAAGTGTAGCTGT | 1630-1649 | As B19V-NS1-PCR (2nd PCR) |
7 | NS-30 | CCAACTAACAGTTCACGAAAC | 2172-2192 | Sense B19V-NS1-PCR (RT/1st PCR) |
8 | NS-32 | TAACAGTTCACGAAACTGGTC | 2168-2187 | As B19V-NS1-PCR (2nd PCR) |
9 | NS-38 | ATTCCACAAATTGCTGATACAC | 2498-2519 | As RFLP-PCR (1st PCR) |
10 | NS-40 | AATTGCTGATACACAGCTTTAG | 2490-2511 | As RFLP-PCR (2nd PCR) |
11 | G2170 | CAGTTTCGTGAACTGTTAGT | 2170-2189 | Sense RFLP-PCR (1st PCR) |
12 | G2176 | CGTGAACTGTTAGTTGGGGTTGA | 2176-2198 | Sense RFLP-PCR (2nd PCR) |
- Citation: Bock CT, Düchting A, Utta F, Brunner E, Sy BT, Klingel K, Lang F, Gawaz M, Felix SB, Kandolf R. Molecular phenotypes of human parvovirus B19 in patients with myocarditis. World J Cardiol 2014; 6(4): 183-195
- URL: https://www.wjgnet.com/1949-8462/full/v6/i4/183.htm
- DOI: https://dx.doi.org/10.4330/wjc.v6.i4.183