Elevated retinol binding protein 4 levels are associated with atherosclerosis in diabetic rats via JAK2/STAT3 signaling pathway

Table 1 Primer sequences of target genes and internal reference genes

Gene	Amplicon size (bp)	Forward primer (5'→3')	Reverse primer (5'→3')
β-actin	150	CCCATCTATGAGGGTTACGC	TTTAATGTCACGCACGATTTC
Cyclin D1	138	TCAAGTGTGACCCGGACTG	GACCAGCTTCTTCCTCCACTT
STAT3	115	GCAATACCATTGACCTGCCG	AACGTGAGCGACTCAAACTG
RBP4	131	GCGAGGAAACGATGACCACT	TGGGGTCACGAGAAAACACA
JAK2	179	ACAAGCAGGACGGGAAGGTC	AATTGGGCCGTGACAGTTGC
Bcl2	102	GAGTACCTGAACCGGCATCT	GAAATCAAACAGAGGTCGCA

Table 2 Comparison of indicators among each group

Index	Group NC (n = 20)	Group DM (n = 25)	Group DA (n = 25)	F	P value
Weight (kg)	491.84 ± 80.82	504.61 ± 63.16	526.07 ± 85.66	1.155	0.321
TG (mmol/L)	0.65 ± 0.10	1.36 ± 0.17a	1.82 ± 0.28a,b	191.339	< 0.001
LDL-c (mmol/L)	0.35 ± 0.12	0.49 ± 0.12a	0.57 ± 0.14a,b	17.562	< 0.001
HDL-c (mmol/L)	1.07 ± 0.19	0.98 ± 0.20	0.71 ± 0.11a,b	27.856	< 0.001
TC (mmol/L)	1.98 ± 0.39	2.23 ± 0.42	2.95 ± 0.50 a,b	30.234	< 0.001
FPG (mmol/L)	5.42 ± 0.82	13.37 ± 2.16a	14.04 ± 2.40a	125.463	< 0.001
FINS (mU/L)	9.84 ± 1.99	14.42 ± 2.12a	19.24 ± 3.17a,b	77.990	< 0.001
HbA1C (%)	5.10 ± 0.81	9.95 ± 2.02a	10.86 ± 1.65a	78.800	< 0.001
RBP4 (ng/mL)	15.37 ± 2.07	21.23 ± 2.70a	32.28 ± 4.68a,b	144.583	< 0.001
AI	0.58 ± 0.23	1.71 ± 0.71a	3.31 ± 0.76a,b	105.551	< 0.001
HOMA-IR	2.38 ± 0.62	8.49 ± 1.36a	12.24 ± 2.82a,b	149.994	< 0.001

^aP < 0.05 vs control group.

^bP < 0.05 vs diabetic rat group. NC: Control group; DM: Diabetic rat group; DA: Diabetic atherosclerotic rat group; TG: Triglycerides; LDL-c: Low-density lipoprotein cholesterol; HDL-c: High-density lipoprotein cholesterol; TC: Total cholesterol; FPG: Fasting plasma glucose; FINS: Fasting insulin; HbA1C: Hemoglobin A1c; RBP4: Retinol binding protein 4; AI: Atherogenic indexes; HOMA-IR: Homeostasis model assessment of insulin resistance.

Table 3 Immunohistochemical analysis of Cyclin D1 and B-cell lymphoma-2 protein expression in all groups

Index	Group NC (%)	Group DM (%)	Group DA (%)	F	P value
Cyclin D1	6.84 ± 1.03	10.24 ± 1.78a	14.71 ± 2.26a,b	15.017	0.005
Bcl-2	7.25 ± 0.96	10.44 ± 1.21a	13.28 ± 2.04a,b	12.510	0.007

^aP < 0.05 vs control group.

^bP < 0.05 vs diabetic rat group.

NC: Control group; DM: Diabetic rat group; DA: Diabetic atherosclerotic rat group; Bcl-2: B-cell lymphoma-2.

Table 4 Correlation between serum retinol binding protein 4 and the other indicators in type 2 diabetes groups (n = 50)

Indicator	r	P value
Weight (kg)	0.121	0.401
TG (mmol/L)	0.622	< 0.001
LDL-c (mmol/L)	0.395	0.005
HDL-c (mmol/L)	-0.566	< 0.001
TC (mmol/L)	0.586	< 0.001
AI	0.716	< 0.001
FPG (mmol/L)	0.111	0.444
FINS (mU/L)	0.556	< 0.001
HOMA-IR	0.541	< 0.001
HbA1C (%)	0.284	0.045
JAK2	0.239	0.094
p-JAK2	0.433	0.002
STAT3	-0.040	0.781
p-STAT3	0.539	< 0.001
Cyclin D1	0.476	< 0.001
Bcl-2	0.325	0.021

TG: Triglycerides; LDL-c: Low-density lipoprotein cholesterol; HDL-c: High-density lipoprotein cholesterol; TC: Total cholesterol; FPG: Fasting plasma glucose; FINS: Fasting insulin; HbA1C: Hemoglobin A1c; RBP4: Retinol binding protein 4; HOMA-IR: Homeostasis model assessment of insulin resistance; JAK2: Janus kinase 2; p-JAK2: Phosphorylated Janus kinase 2; STAT3: Signal transducer and activator of transcription 3; p-STAT3: Phosphorylated signal transducer and activator of transcription-3; Bcl-2: B-cell lymphoma-2.

Table 5 Multivariable logistic regression in type 2 diabetes groups (n = 50)

Variable	β value	SE	χ2	OR	95%CI	P value
RBP4	0.951	0.338	7.933	2.589	1.335-5.019	0.005
LDL-c	5.211	2.421	4.631	18.253	1.592-39.597	0.031
p-JAK2	2.040	0.866	5.554	7.693	1.410-41.979	0.018
p-STAT3	2.734	1.187	5.305	15.402	1.503-57.794	0.021
Constant	-21.007	7.916	7.041	0.000		0.008

CI: Confidence interval; OR: Odds ratio; RBP4: Retinol binding protein 4; LDL-c: Low-density lipoprotein cholesterol; p-JAK2: Phosphorylated Janus kinase 2; p-STAT3: Phosphorylated signal transducer and activator of transcription-3.