Characterization and strong risk association of TLR2 del -196 to -174 polymorphism and Helicobacter pylori and their influence on mRNA expression in gastric cancer

Table 1 Epidemiological data of individuals with normal gastric mucosa (control group, chronic gastritis, and gastric cancer patients), n (%)

Variables	Control, n = 381	Chronic gastritis, n = 269	Gastric cancer, n = 202
Gender
Female	205 (53.8)	146 (54.3)	50 (24.8)
Male	176 (46.2)	123 (45.7)	152 (75.2)
Age in yr
mean ± SD	51.26 ± 16.77	50.89 ± 23.03	66.26 ± 16.32
Smoking
Yes	79 (20.7)	84 (31.2)	142 (70.3)
No	302 (79.3)	185 (68.8)	60 (29.7)
Drinking
Yes	98 (25.7)	115 (42.7)	128 (63.3)
No	281 (74.3)	154 (57.3)	74 (36.7)
Helicobacter pylori
Positive	0 (0)	122 (45.3)	86 (42.6)
Negative	381 (100)	147 (54.7)	116 (57.4)

Table 2 Nucleotide primer sequences, PCR conditions, and minor allele frequency for polymorphisms TLR2 -196 to -174 ins/del (rs111200466) and TLR2 19216T/C (rs3804099)

Genes	Location	MAF	Primers, 5’-3’	Cycles	T° melting	Enzyme	Genotypes, bp
TLR2 -196 to -174 ins/del (rs111200466)	Chromosome 4:153684312-153684338 (intron variant)	0.1952 (del)	F: CACGGAGGCAGCGAGAAA	35	60 °C	-	ins/ins: 286 bp
			R: CTGGGCCGTGCAAAGAAG				ins/del: 286 + 264 bp
							del/del: 264 bp
TLR2 19216T/C (rs3804099)	Chromosome 4:153703504 (synonymous variant)	0.4048(C)	F: TCCCTGGGCAGTCTTGAACATTTAG	30	65 °C	TaiI	TT: 415 bp
							TC: 415 + 109 + 306 bp
			R: TGTCCAAATCAGTATCTCGCAGTTCC				CC: 306 + 109 bp

MAF: Minor allele frequency - extracted from 1000 Genomes Project Phase 3; bp: Base pairs R: Reverse; F: Forward.

Table 3 Genotype frequencies of TLR2 -196 to -174 ins/del and TLR2 19216 T/C polymorphisms in both case and control groups (GC vs C, CG vs C and GC vs CG) , n (%)

Polymorphisms	Models	Genotypes	C, n = 381	Case
				GC			CG			GC x CG
				n = 202	OR (95%CI)	P value	n = 269	OR (95%CI)	P value	OR (95%CI)	P value
TLR2 -196 to -174 ins/del (rs111200466)	Codomi-nant	ins/ins	316 (82.9)	112 (55.5)	1.00	< 0.0001	212 (78.8)	1.00	0.4100	1.00	< 0.0001
		ins/del	60 (15.8)	79 (39.1)	3.70 (2.41-5.70)		53 (19.7)	1.32 (0.88-1.98)		2.68 (1.71-4.20)
		del/del	5 (1.3)	11 (5.5)	5.73 (1.80-18.21)		4 (1.5)	1.19 (0.32-4.49)		5.06 (1.45-17.70)
	Dominant	ins/ins	316 (82.9)	112 (55.5)	1.00	< 0.0001	212 (78.8)	1.00	0.1900	1.00	< 0.0001
		ins/del	65 (17.1)	90 (44.5)	3.87 (2.55-5.86)		57 (21.2)	1.31 (0.88-1.94)		2.84 (1.84-4.39)
		del/del
	Recessive	ins/ins	376 (98.7)	191 (94.5)	1.00	0.0130	265 (98.5)	1.00	0.8500	1.00	0.0260
		ins/del
		del/del	5 (1.3)	11 (5.5)	4.00 (1.27-12.62)		4 (1.5)	1.13 (0.30-4.26)		3.77 (1.08-13.12)
	Overdo-minant	ins/ins	321 (84.2)	123 (60.9)	1.00	< 0.0001	216 (80.3)	1.00	0.1900	1.00	< 0.0001
		del/del
		ins/del	60 (15.8)	79 (39.1)	3.44 (2.24-5.27)		53 (19.7)	1.31 (0.87-1.97)		2.49 (1.59-3.88)
	Log-additive	---	---	---	3.23 (2.23-4.69)	< 0.0001	---	1.25 (0.88-1.79)	0.2200	2.54 (1.72-3.74)	< 0.0001
TLR2 19216T/C (rs3804099)	Codomi-nant	T/T	157 (41.2)	101 (50.0)	1.00	0.0920	131 (48.7)	1.00	0.1600	1.00	0.8900
		T/C	175 (45.9)	83 (41.1)	0.72 (0.49-1.06)		106 (39.4)	0.73 (0.52-1.01)		0.95 (0.63-1.44)
		C/C	49 (12.9)	18 (8.9)	0.56 (0.30-1.05)		32 (11.9)	0.78 (0.47-1.29)		0.85 (0.43-1.69)
	Dominant	T/T	157 (41.2)	101 (50.0)	1.00	0.0420	131 (48.7)	1.00	0.0580	1.00	0.7100
		T/T	224 (58.8)	101 (50.0)	0.68 (0.45-0.99)		138 (51.3)	0.74 (0.54-1.01)		0.93 (0.63-1.38)
		T/C
	Recessive	T/T	332 (87.1)	184 (91.1)	1.00	0.1600	237 (88.1)	1.00	0.7100	1.00	0.6800
		T/C
		C/C	49 (12.9)	18 (8.9)	0.65 (0.36-1.19)		32 (11.9)	0.91 (0.57-1.47)		0.87 (0.45-1.68)
	Overdo-minant	T/T	206 (54.1)	119 (58.9)	1.00	0.2500	163 (60.6)	1.00	0.0970	1.00	0.9000
		C/C
		T/C	175 (45.9)	83 (41.1)	0.81 (0.56-1.17)		106 (39.4)	0.77 (0.56-1.05)		0.98 (0.65-1.46)
	Log-additive	---	---	---	0.74 (0.56-0.97)	0.0300	---	0.83 (0.66-1.05)	0.1200	0.93 (0.69-1.26)	0.6400

C: Control; CG: Chronic gastritis; GC: Gastric cancer.

Table 4 Genotype frequencies of TLR2 -196 to -174 ins/del and TLR2 19216T/C polymorphisms in Helicobacter pylori-positive and Helicobacter pylori-negative groups, n (%)

Polymorphisms	Models	Genotypes/ alleles	Case
			H. pylori-positive, n = 619	H. pylori-negative, n = 233	OR (95%CI)	P value
TLR2 -196 to -174 ins/del (rs111200466)	Codominant	ins/ins	481 (77.7)	159 (68.2)	1.00	0.0120
		ins/del	127 (20.5)	65 (27.9)	1.55 (1.09-2.19)
		del/del	11 (1.8)	9 (3.9)	2.48 (1.01-6.08)
	Dominant	ins/ins	481 (77.7)	159 (68.2)	1.00	0.0051
		ins/del	138 (22.3)	74 (31.8)	1.62 (1.16-2.27)
		del/del
	Recessive	ins/ins	608 (98.2)	224 (96.1)	1.00	0.0880
		ins/del
		del/del	11 (1.8)	9 (3.9)	2.22 (0.91-5.43)
	Overdo-minant	ins/ins	492 (79.5)	168 (72.1)	1.00	0.0240
		del/del
		ins/del	127 (20.5)	65 (27.9)	1.50 (1.06-2.12)
	Log-additive	---	---	---	1.56 (1.17-2.08)	0.0030
TLR2 19216T/C (rs3804099)	Codominant	T/T	261 (42.2)	128 (54.9)	1.00	0.0039
		T/C	281 (45.4)	83 (35.6)	0.60 (0.44-0.83)
		C/C	77 (12.4)	22 (9.4)	0.58 (0.35-0.98)
	Dominant	T/T	261 (42.2)	128 (54.9)	1.00	< 0.0001
		T/C – C/C	358 (57.8)	105 (45.1)	0.60 (0.44-0.81)
	Recessive	T/T – T/C	542 (87.6)	211 (90.6)	1.00	0.2200
		C/C	77 (12.4)	22 (9.4)	0.73 (0.45-1.21)
	Overdo-minant	T/T – C/C	338 (54.6)	150 (64.4)	1.00	0.0097
		T/C	281 (45.4)	83 (35.6)	0.67 (0.49-0.91)
	Log-additive	---	---	---	0.70 (0.55-0.88)	0.0021

H. pylori: Helicobacter pylori.

Table 5  TLR2 gene expression level groups to assess influence of polymorphic genotypes in gastric cancer and chronic gastritis

Groups		TLR2-196 to -174ins/del		P value	TLR2-19216 T/C		P value
		ins/ins	ins/del + del/del		TT	TC/CC
GC (n = 36)	Median	2.58	8.74	0.00101	18.54	3.63	0.00041
	Interquartile range	1.45-7.26	7.50-34.66		11.82-35.55	1.62-7.76
CG (n = 48)	Median	0.92	0.79	0.5334	0.92	0.71	0.8827
	Interquartile range	0.56-1.09	0.48-1.92		0.53-1.53	0.49-1.44

¹Mann Whitney U Test. Data are presented as the relative quantification (RQ) median with interquartile range. Significant difference (P < 0.05).