A mutation of the start codon in the X region of hepatitis B virus DNA in a patient with non-B, non-C chronic hepatitis

Table 1 Laboratory findings at first visit

Parameter	Value	Partameter	Value	Parameter	Value
Peripheral blood		Biochemistry		Viral marker
WBC (/μL)	3800	AST (IU/L)	41	HBsAg (COI)	1.4
RBC (× 104/μL)	365	ALT (IU/L)	62	Anti-HBs (COI)	0
Hb (g/dL)	12.2	ZTT (U)	17.7	Anti-HBc (S/CO)	< 1.0
Ht (%)	37.5	LDH (IU/L)	213	HBeAg (COI)	< 0.5
Plt (× 104/μL)	12.8	ChE (U/L)	5.8	Anti-HBe (%)	< 35.0
		γGT (IU/L)	39	Anti-HCV (COI)	0.2
Coagulation		ALP (IU/L)	265
HPT (%)	87	TBil (mg/dL)	0.8	Autoantibody
		DBil (mg/dL)	0.3	ANA	(-)
Urinalysis		UN (mg/dL)	15	AMA	(-)
Protein	(-)	Cr (mg/dL)	0.5
Sugar	(-)	TP (g/dL)	8.6	Others
Bilirubin	(-)	Alb (g/dL)	4.9	ICG-R15 (%)	12
Urobilinogen	(±)	TC (mg/dL)	235	AFP (ng/mL)	2.6
		TG (mg/dL)	40

WBC: while blood cells; RBC: red blood cells; Hb: hemoglobin; Ht: hematocrit; Plt: platelets; HPT: hepaplastin test; AST: aspartate aminotransferase; ALT: alanine aminotransferase; ZTT: zinc turbidity test; LDH: lactic dehydrogenase; ChE: choline esterase;γGT: gamma-glutamyl transpeptidase; ALP: alkaline phosphatase; TBil: total bilirubin; DBil: direct bilirubin; UN: urea nitrogen; Cr : creatinin; TP: total protein; Alb: albumin; TC: total cholesterol; TG: triglyceride; HBsAg: hepatitis B surface antigen; anti-HBs: hepatitis B surface antibody; anti-HCV: hepatitis C virus antibody; ANA: anti-nuclear antibody; AMA: anti-mitochondrial antibody; ICG-R15: indocyanine green retention rate at 15 min; AFP: alpha-fetoprotein.

Table 2 Primers for the amplification of the precore region and all remaining regions of hepatitis B virus DNA in nested polymerase chain reaction

	Primer	Sequence	Positiona
PreC region	1st forward	5'GGGAGGAGATTAGGTTAA3'	1744
	1st reverse	5'GGCAAAAAAGAGAGTAACTC3'	1959
	2nd forward	5'TAGGAGGCTGTAGGCATAA3'	1774
	2nd reverse	5'GCTCCAAATTCTTTATA3'	1932
	Cycling protocol: 94°C 1 min - 55°C 1 min - 68°C 3 min (25 cycles)
All remaining regions (long PCR)	1st forward	5'CCTATAAAGAATTTGGAGC3'	1914
	1st reverse	5'TTTATGCCTACAGCCTCC3'	1793
	2nd forward	5'GAGTTACTCTCTTTTTTGC3'	1940
	2nd reverse	5'ACCTTTAACCTAATCTCCT3'	1765
	Cycling protocol: 95°C 1 min - 57°C 1 min - 68°C 3 min (35 cycles)

^aHBV DNA is composed of 3215 bases and starts from the Eco RI cleavage site within pre-S/S open reading frame[9]. PCR: polymerase chain reaction.