Copyright
©20???? Baishideng Publishing Group Co.
World J Hepatol. Feb 27, 2011; 3(2): 56-60
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56
Table 1 Laboratory findings at first visit
Parameter | Value | Partameter | Value | Parameter | Value |
Peripheral blood | Biochemistry | Viral marker | |||
WBC (/μL) | 3800 | AST (IU/L) | 41 | HBsAg (COI) | 1.4 |
RBC (× 104/μL) | 365 | ALT (IU/L) | 62 | Anti-HBs (COI) | 0 |
Hb (g/dL) | 12.2 | ZTT (U) | 17.7 | Anti-HBc (S/CO) | < 1.0 |
Ht (%) | 37.5 | LDH (IU/L) | 213 | HBeAg (COI) | < 0.5 |
Plt (× 104/μL) | 12.8 | ChE (U/L) | 5.8 | Anti-HBe (%) | < 35.0 |
γGT (IU/L) | 39 | Anti-HCV (COI) | 0.2 | ||
Coagulation | ALP (IU/L) | 265 | |||
HPT (%) | 87 | TBil (mg/dL) | 0.8 | Autoantibody | |
DBil (mg/dL) | 0.3 | ANA | (-) | ||
Urinalysis | UN (mg/dL) | 15 | AMA | (-) | |
Protein | (-) | Cr (mg/dL) | 0.5 | ||
Sugar | (-) | TP (g/dL) | 8.6 | Others | |
Bilirubin | (-) | Alb (g/dL) | 4.9 | ICG-R15 (%) | 12 |
Urobilinogen | (±) | TC (mg/dL) | 235 | AFP (ng/mL) | 2.6 |
TG (mg/dL) | 40 |
Table 2 Primers for the amplification of the precore region and all remaining regions of hepatitis B virus DNA in nested polymerase chain reaction
Primer | Sequence | Positiona | |
PreC region | 1st forward | 5'GGGAGGAGATTAGGTTAA3' | 1744 |
1st reverse | 5'GGCAAAAAAGAGAGTAACTC3' | 1959 | |
2nd forward | 5'TAGGAGGCTGTAGGCATAA3' | 1774 | |
2nd reverse | 5'GCTCCAAATTCTTTATA3' | 1932 | |
Cycling protocol: 94°C 1 min - 55°C 1 min - 68°C 3 min (25 cycles) | |||
All remaining regions (long PCR) | 1st forward | 5'CCTATAAAGAATTTGGAGC3' | 1914 |
1st reverse | 5'TTTATGCCTACAGCCTCC3' | 1793 | |
2nd forward | 5'GAGTTACTCTCTTTTTTGC3' | 1940 | |
2nd reverse | 5'ACCTTTAACCTAATCTCCT3' | 1765 | |
Cycling protocol: 95°C 1 min - 57°C 1 min - 68°C 3 min (35 cycles) |
- Citation: Fujise K, Tatsuzawa K, Kono M, Hoshina S, Tsubota A, Niiya M, Namiki Y, Tada N, Tajiri H. A mutation of the start codon in the X region of hepatitis B virus DNA in a patient with non-B, non-C chronic hepatitis. World J Hepatol 2011; 3(2): 56-60
- URL: https://www.wjgnet.com/1948-5182/full/v3/i2/56.htm
- DOI: https://dx.doi.org/10.4254/wjh.v3.i2.56