Interleukin-6-174G/C polymorphism is associated with a decreased risk of type 2 diabetes in patients with chronic hepatitis C virus

Table 1 Probes and conditions used in the polymerase chain reaction to genotype interleukin 6 single nucleotide polymorphism at position-174 (rs1800795)

IL-6 Gene-174 (rs1800795)
ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA	60 ºC–1 min; 95 ºC–10 min; 50 cycles (95 ºC–15 s, 60 ºC–90 s) and 60 ºC–1 min

IL-6: Interleukin 6.

Table 2 The interleukin genotype distribution in patients with chronic hepatitis C (n = 245) and healthy controls (n = 179)

Variables	CHC, n (%)	Control, n (%)	P value
IL-6 genotypes
-174			0.81
C/C	18 (7.3)	13 (7.3)
G/C	85 (34.7)	68 (38.0)
G/G	142 (58.0)	98 (54.7)
Total	245 (100)	179 (100)
HWE (P value)	0.38	0.95

The asymptotic Pearson’s χ² test was used to compare categorical variables. P ≤ 0.05 were considered significant. n: Number of subjects; CHC: Chronic hepatitis C; IL-6: Interleukin-6; HWE: Hardy-Weinberg Equilibrium.

Table 3 Demographic, clinical comorbidity, nutritional status, liver fibrosis stage, virological, cytokine genotyping data of the chronically hepatitis C virus-infected patients with (n = 51) and without type 2 diabetes (n = 194)

Variables	Type 2 diabetes, n (%)	Non-type 2 diabetes, n (%)	P value
Demographic
Male	27 (52.9)	102 (52.6)	1.0
Female	24 (47.1)	92 (47.4)
Age (yr)1	55.5 ± 9.6	50.9 ± 11.7	0.01
Clinical comorbidity
Blood hypertension	36 (70.6)	62 (32.0)	< 0.001
Nutritional status
Body mass index (Kg/m2)2	27.0 (24.1-29.7)	25.6 (23.5-28.4)	0.11
Stage of liver disease
Chronic hepatitis C	28 (54.9)	123 (63.4)	0.34
Liver cirrhosis	23 (45.1)	71 (36.6)
Virological parameters
Viral load HCV-RNA [Log10 (IU/mL)]2	5.98 (5.66-6.24)	5.84 (5.30-6.40)	0.38
Genotype 1	40/45 (88.9)	130/159 (81.7)	0.37
IL-6 polymorphism
IL-6-174G/G genotypes			0.04
G/G	37 (72.5)	105 (54.1)
G/C	13 (25.5)	72 (37.1)
C/C	1 (2.0)	17 (8.8)
Total	51 (100.0)	194 (100.0)
HWE (P value)	0.65	0.47

¹mean ± SD.

²Median and IQR, 25^th-75^th percentile. HCV: Hepatitis C virus; n: Number of subjects; IL: Interleukin; HWE: Hardy-Weinberg Equilibrium. The asymptotic Pearson’s χ² test was used to compare categorical variables. The t test and Mann-Whitney U test were used for comparison of means and medians, respectively. P ≤ 0.05 were considered significant.

Table 4 Variables associated with diabetes mellitus in patients with chronic hepatitis C

Variables	Multivariate analysis
	OR	95%CI	P value
Age	1.01	0.98-1.05	0.43
Body mass index	1.03	0.96-1.09	0.45
Hypertension	5.56	2.79-11.09	< 0.001
IL-6-174 G/C (GC and CC)	0.42	0.22-0.78	0.006

CI: Confidential interval; IL-6: Interleukin 6; OR: Odds ratio.