Effect of Maotai liquor in inducing metallothioneins and on hepatic stellate cells

Table 1 Primer sequence and expected PCR product length

Primer designation	Sequence	Product length
α1 (I) upstream	CACCCTCAAGAGCCTGAGTC	253 bp
α1 (I) downstream	GTT CGGGCTGATGTACCAGT
β-actin upstream	ACATCTGCTGGAAGGTGGAC	163 bp
β-actin downstream	GGTACCACCATGTACCCAGG

Table 2 The effect of Maotai liquor on MT and MDA in rats liver (n = 10, ^-x±s)

Group	MT (ng·g-1)	MDA (ng·g-1)
Control group	10.0 ± 2.8	60.2 ± 3.1
Maotai liquor group	216.0 ± 10.8b	60.1 ± 2.4
CCL4 Group	126.4 ± 4.8b	150.8 ± 6.7b
CCL4 + Maotai liquor group	304.8 ± 12.1bd	102.0 ± 3.44bd

^bP < 0.01, vs control group;

^dP < 0.01, vs CCL₄ group (analysis of variance and q test)

Table 3 The effect of Maotai liquor on HSC of human (n = 3, ^-x±s)

Group	Inhibiting Rate of HSC
Alcohol group (10 g·L-1)	-8.4 ± 2.3
Maotai liquor group (0.5 g·L-1)	-4.52 ± 0.3
Maotai liquor group (1 g·L-1)	12.4 ± 10.4b
Maotai liquor group (5 g·L-1)	17.4 ± 1.6b
Maotai liquor group (10 g·L-1)	16.4 ± 2.3b

^bP < 0.01, vs alcohol group