Thymoquinone affects hypoxia-inducible factor-1α expression in pancreatic cancer cells via HSP90 and PI3K/AKT/mTOR pathways

Table 1 Genomic DNA removal

Constituent	Dose
Template RNA	1.76 μg
4 × gDNA wiper Mix	4 μL
RNase-free ddH2O	16 μL

Incubate at 42 ℃ for 2 min.

Table 2 Preparation of reverse transcriptional response system

Constituent	Dose
5 × HiScript II Select qRT SuperMix II	4 μL
Reaction liquid from step 1	16 μL
Reverse transcriptase	1 μL

Incubate at 50 ℃ for 15 min; Incubate at 85 ℃ for 5 s; Incubate at 4 ℃ for 10 min.

Table 3 Primer sequence

Gene	Primer	Sequence (5'-3')	PCR product
Homo GAPDH	Upstream	TCAAGAAGGTGGTGAAGCAGG	115 bp
	Downstream	TCAAAGGTGGAGGAGTGGGT
Homo HIF-1α	Upstream	GTGGCGAAGATGGTCAAGTC	116 bp
	Downstream	GGAGTGCCCTTGTTGAGGTGTT

HIF-1α: Hypoxia-inducible factor-1α; PCR: Polymerase chain reaction.

Table 4 Real-time fluorescence quantitative polymerase chain reaction system

Constituent	Dose
cDNA	4 μL
Forward Primer (10 μM)	0.4 μL
Reverse Primer (10 μM)	0.4 μL
SYBR Green Master Mix	10 μL
50 × ROX Reference Dye 2	0.4 μL
Taq Plus DNA Polymerase	1 μL
RNase-free ddH2O	25 μL

Table 5 Real-time fluorescence quantitative polymerase chain reaction program

Item	Temperature	Time	Cycle-index
Predegeneration	95 ℃	10 min	1
Denaturation	95 ℃	15 s	40
Annealing elongation	60 ℃	60 s	40
Melting curve acquisition	95 ℃	15 s	1
	60 ℃	60 s	1
	95 ℃	15 s	1

Table 6 Preparation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation glue

Reagent	Separation glue concentration (%)
	8%	10%	12%	15%	18%	20%
H2O	4.63 mL	4 mL	3.3 mL	2.3 mL	1.3 mL	0.63 mL
30% acrylamide (29: 1)	2.67 mL	3.3 mL	4 mL	5 mL	6 mL	6.67 mL
1.5M Tris-HCl (pH 8.8)	2.5 mL	2.5 mL	2.5 mL	2.5 mL	2.5 mL	2.5 mL
10%SDS	0.1 mL	0.1 mL	0.1 mL	0.1 mL	0.1 mL	0.1 mL
Ammonium persulfate	0.1 mL	0.1 mL	0.1 mL	0.1 mL	0.1 mL	0.1 mL
TEMED	5 μL	5 μL	5 μL	5 μL	5 μL	5 μL
Bulk volume	10 mL	10 mL	10 mL	10 mL	10 mL	10 mL

SDS: Sodium dodecyl sulfate.

Table 7 Preparation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis concentrated glue

Reagent	Concentration
H2O	2 mL	3 mL	4 mL	6 mL
30% acrylamide (29:1)	0.5 mL	0.75 mL	1 mL	1.5 mL
1M TRIS-HCl (pH 6.8)	0.5 mL	0.75 mL	1 mL	1.5 mL
10%SDS	40 μL	60 μL	80 μL	120 μL
Ammonium persulfate	30 μL	45 μL	60 μL	90 μL
TEMED	4 μL	6 μL	8 μL	12 μL
Bulk volume	3 mL	4.5 mL	6 mL	9 mL

SDS: Sodium dodecyl sulfate.

Table 8 Objective fragment double enzyme digestion process

Constituent	Dose
1 × Tango Buffer	2.0 μL
BamH I	0.5 μL
EcoR I	0.5 μL
Objective fragment	8.0 μL
ddH2O	9.0 μL
Total dose	20.0 μL

Water bath at 37 ℃ for 2 h.

Table 9 Carrier double enzyme digestion process

Constituent	Dose
1 × Tango Buffer	2.0 μL
BamH I	0.5 μL
EcoR I	0.5 μL
Carrier plasmid DNA	8.0 μL
ddH2O	9.0 μL
Total dose	20.0 μL

Water bath at 37 ℃ for 2 h.

Table 10 Connection system processing

Constituent	Dose
2 × Sosoo Cloning MIX	5.0 μL
pLVX-SV40-IRES-EGFP-Puro	2.0 μL
Target fragment	2.0 μL
ddH2O	1.0 μL

Recombined at 50 ℃ for 30 min.

Table 11 Culture solution identified by polymerase chain reaction

Constituent	Dose
EntilinkTM PCR Master Mix	25.0 μL
Forward Primer (10 μM)	2.0 μL
Reverse Primer (10 μM)	2.0 μL
Template	Appropriate amount
ddH2O	Up to 50 μL

37 ℃ water bath overnight. PCR: Polymerase chain reaction.

Table 12 shRNA annealing reaction system

Constituent	Dose
10 × annealing buffer	5 μL
Forward Primer (10 μM)	10 μL
Reverse Primer (10 μM)	10 μL
ddH2O	Up to 50 μL

Table 13 shRNA annealing polymerase chain reaction conditions

Procedure	Temperature	Time	Cycle-index
Predegeneration	95 ℃	2 min	10
Degeneration	95 ℃	30 s
Anneal	60 ℃	30 s
Final insulation	4 ℃	Unlimited

Table 14 Recombinant plasmid linking system

Constituent	Dose
10 × ligase Buffer	2.0 μL
pLVshRNA-EGFP(2A)Puro double enzyme digestion vector	2.0 μL
Target fragment	2.0 μL
Ligase	0.5 μL
ddH2O	1.0 μL

Recombination at 22 ℃ for 2 h connection.