Copyright
©The Author(s) 2023.
World J Gastroenterol. Dec 28, 2023; 29(48): 6179-6197
Published online Dec 28, 2023. doi: 10.3748/wjg.v29.i48.6179
Published online Dec 28, 2023. doi: 10.3748/wjg.v29.i48.6179
Table 1 MicroRNAs involved in follicular lymphoma development and proliferation
MicroRNA(s) | Role in FL development | Sequence (5’ to 3’) | Ref. |
miR-17 | Involved in cell proliferation and apoptosis | UAAAGUGCUUACAGUGCAGGUAG | [23-26] |
miR-18a | Role in angiogenesis and tumorigenesis | UAAGGUGCAUCUAGUGCAGAUAG | [26] |
miR-19a | Promotes cell survival | UGUGCAAAUCUAUGCAAAACUGA | [26] |
miR-20a | Involved in cell cycle regulation | UAAAGUGCUCAUAGUGCAGGUAG | |
miR-19b-1 | Promotes cell survival | UGUGCAAAUCCAUGCAAAUCUGA | |
miR-92a | Role in angiogenesis | UAUUGCACUUGUCCCGGCCUGU | [26] |
miR-155 | B-cell transformation in follicular lymphoma | UUAAUGCUAAUUGUGAUAGGGGU | [27-35] |
miR-21 | Overexpressed and promotes tumor progression | UAGCUUAUCAGACUGAUGUUGA | [35] |
miR-155-5p | Role for diagnosis of FL | UUAAUGCUAAUCGUGAUAGGGGU | [33,36] |
miR-150 | Influences B-cell differentiation | UCUCACAUUGGUCUACAAUCU | [33,36,41] |
miR-9-3p | Role for diagnosis of FL and in B-cell malignancies | UCUUUGGUUAUCUAGCUGUAUGA | [36-40] |
miR-29 family | Epigenetic regulation and tumorigenesis | Varies by family member | [42] |
miR-5008 | Regulation of endogenous mRNA levels | Sequence is not available | [43] |
miR-7e-5p | Downregulation by c-MYC over-expression arise poor prognosis of FL | UGAGGUAGGAGGUUGUAUAGUU | [44] |
miR-451 | Involved in cell cycle progression | AAACCGUUACCAUUACUGAGUU | [45] |
miR-338-5p | Possible role in cellular proliferation | UAAUGACUGCACUGACCUUUGA | [45] |
miR-142 | Role in hematopoiesis and B-cell function | UGUAGUGUUUCCUACUUUAUGGA | [46] |
miR-376 cluster | Involvement in cellular differentiation | Varies by cluster member | [42] |
Table 2 Lugano staging of gastrointestinal tract lymphoma[60]
Stage | |
I | Tumor confined to GI tract |
Primary site or multiple, non-contiguous lesions | |
II | Tumor extends into the abdomen from primary GI site |
Nodal involvement | |
II1 | Local: Paragastric in cases of gastric lymphoma and para-intestinal for intestinal lymphoma |
II2 | Distant: Mesenteric in case of an intestinal primary lymphoma; otherwise paraaortic, paracaval, pelvic, or inguinal |
IIE | Penetration of serosa involving adjacent organs or tissues: Enumerate sites of involvement, e.g., IIE (pancreas), IIE (large intestine), IIE (post-intestinal wall) |
Where there is nodal involvement and penetration involving adjacent organs, the stage is denoted using a subscript (1 or 2) and E, e.g., II1E (pancreas) | |
IV | Disseminated extra-nodal involvement or a GI tract lesion with supradiaphragmatic nodal involvement |
- Citation: Watanabe T. Gene targeted and immune therapies for nodal and gastrointestinal follicular lymphomas. World J Gastroenterol 2023; 29(48): 6179-6197
- URL: https://www.wjgnet.com/1007-9327/full/v29/i48/6179.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i48.6179