Copyright
©The Author(s) 2023.
World J Gastroenterol. May 21, 2023; 29(19): 2950-2960
Published online May 21, 2023. doi: 10.3748/wjg.v29.i19.2950
Published online May 21, 2023. doi: 10.3748/wjg.v29.i19.2950
Table 1 Primers used in this study for multiplex polymerase chain reaction for detection of vacA and cagA genotypes in Helicobacter pylori isolates
Primer | Nucleotide sequence, 5'—3' | Gene | Size, bp |
vacA | |||
VA1-F | ATGGAAATACAACAAACACAC | vacA s1/s2 | 259/286 |
VA1-R | CTGCTTGAATGCGCCAAAC | ||
VA2-F | CAATCTGTCCAATCAAGCGAG | vacA m1/m2 | 570/645 |
VA2-R | GCGTCAAAATAATTCCAAGG | ||
Cag-F | GTTGATAACGCTGTCGCTTC | cagA | 349 |
Cag-R | GGGTTGTATGATATTTTCCATAA |
Table 2 Patient demographic and clinical characteristics
Variable | n (%) |
Mean age in yr | 39.5 ± 12.9 |
Male sex | 57 (79.2) |
History of smoking | 22 (30.6) |
History of upper abdominal pain | 48 (66.7) |
Endoscopic finding | |
Gastritis | 39 (54.2) |
Gastric ulcer | 24 (33.3) |
Duodenitis | 9 (12.5) |
Co-morbid conditions | |
Liver cirrhosis | 15 (20.8) |
Diabetes mellitus | 9 (12.5) |
Hypertension | 3 (4.2) |
cagA | 36 (50.0) |
vacA | 60 (83.3) |
s1 | 42 (58.3) |
s2 | 18 (25.0) |
m1 | 27 (37.5) |
m2 | 33 (45.8) |
Table 3 Relationship between risk factors and outcomes of Helicobacter pylori eradication therapy, n (%)
Variable | Successful, n = 45 | Unsuccessful, n = 27 | P value |
Mean age in yr | 43.13 ± 12.19 | 39.22 ± 11.91 | 0.188 |
Male sex | 36 | 21 | 0.524 |
Smoking | 15 | 12 | 0.349 |
cagA | 21 (46.7) | 15 (55.6) | 0.313 |
s1 | 31 (68.9) | 11 (40.7) | 0.022 |
s2 | 15 (33.3) | 3 (11.1) | 0.031 |
m1 | 22 (48.9) | 5 (18.5) | 0.014 |
m2 | 21 (46.7) | 12 (44.4) | 0.525 |
AMX | 33 (73.3) | 26 (96.3) | 0.012 |
CIP | 18 (40.0) | 12 (44.4) | 0.45 |
TET | 15 (33.3) | 12 (44.4) | 0.244 |
CLR | 18 (40.0) | 20 (74.1) | 0.005 |
RIF | 27 (60.0) | 18 (40.0) | 0.379 |
Table 4 Multivariate analysis of risk factors accompanied with eradication therapy of Helicobacter pylori
Variable | aOR (95%CI) | P value |
s1 | 0.507 (0.175–0.822) | 0.003 |
s2 | 0.074 (-0.227 to 0.393) | 0.595 |
m1 | -0.028 (-0.291 to 0.234) | 0.83 |
AMX | 0.223 (0.026–0.537) | 0.032 |
CLR | 0.204 (-0.005 to 0.412) | 0.036 |
- Citation: Asaad AM, El-Azab G, Abdelsameea E, Elbahr O, Kamal A, Abdel-Samiee M, Abdelfattah A, Abdallah H, Maher D, El-Refaie A, Ghanem SE, Ansari S, Awad SM. Susceptibility patterns and virulence genotypes of Helicobacter pylori affecting eradication therapy outcomes among Egyptian patients with gastroduodenal diseases. World J Gastroenterol 2023; 29(19): 2950-2960
- URL: https://www.wjgnet.com/1007-9327/full/v29/i19/2950.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i19.2950