Copyright
©The Author(s) 2022.
World J Gastroenterol. Feb 28, 2022; 28(8): 825-839
Published online Feb 28, 2022. doi: 10.3748/wjg.v28.i8.825
Published online Feb 28, 2022. doi: 10.3748/wjg.v28.i8.825
Table 1 Primer sequences, annealing temperature and product size for MS-PCR and EpiTYPER DNA methylation analysis of target genes
Genes | Forward primer (5’ → 3’) | Annealing temperature (°C) | Product size (bp) | |
SUMF2 | M | F:TTTGATTATGGTCGGTTTTGC | 59.4 | 191 |
R:GACTACTTACAACTCCCCTAACGAC | ||||
U | F:TTTTTTGATTATGGTTGGTTTTGTG | 60.6 | 198 | |
R:CCCAACTACTTACAACTCCCCTAACA | ||||
Q | F:TTTGTTATAGAGGGATGGGAGATAG aggaagagag | 60 | 232 | |
R:CAAAATAAACAACACTCCAAATTCA cagtaatacgactcactatagggagaaggct | ||||
ADAMTS5 | M | F:GTTATTGTCGTGGAGCGTTAGC | 59.4 | 170 |
R:CCTACCTCCCGTACTTCCCG | ||||
U | F:TTATTGTTGTGGAGTGTTAGTGTTT | 59.4 | 169 | |
R:CCTACCTCCCATACTTCCCACAT | ||||
Q | F:aggaagagagTTGAAATTGTTATTGTAGGATGGTATG | 61.3 | 245 | |
R:cagtaatacgactcactatagggagaaggctAATTAAAACAAAAATACAAAAAAACAACC | ||||
PXDN | M | F:TATGCGGGACGAGAACGAGA | 61.6 | 137 |
R:ACTTAAACAACTCCGTAACAATACGAT | ||||
U | F:GTGTATGTGGGATGAGAATGAGAG | 60.4 | 142 | |
R:CAACTTAAACAACTCCATAACAATACAA |
Table 2 Characteristics and distribution of methylation status in patients with colorectal cancer (n = 208)
Characteristics | Total | Methylation status | |||||
SUMF2 | ADAMTS5 | PXDN | |||||
Normal | Tumor | Normal | Tumor | Normal | Tumor | ||
Sex | |||||||
Male | 103 (49.5) | 20 (60.6) | 27 (55.1) | 28 (60.9) | 44 (77.2) | 35 (76.1) | 44 (77.2) |
Female | 105 (50.5) | 17 (45.9) | 25 (45.5) | 38 (64.4) | 49 (73.1) | 41 (69.5) | 53 (79.1) |
χ2 (P value) | 0.97 (0.324) | 0.62 (0.432) | 0.03 (0.866) | 0.1 (0.755) | 0.28 (0.596) | < 0.01 (0.969) | |
Age at surgery | |||||||
mean ± SD | 64.3 ± 14.6 | 64.9 ± 14.2 | 66.9 ± 15.8 | 66.4 ± 14.8 | 67.7 ± 15.5 | 65.0 ± 14.4 | 66.2 ± 15.0 |
< 65 | 103 (49.5) | 17 (51.5) | 26 (53.1) | 28 (58.3) | 43 (72.9) | 34 (70.8) | 46 (78.0) |
≥ 65 | 105 (50.5) | 20 (54.1) | 26 (47.3) | 38 (66.7) | 50 (76.9) | 42 (73.7) | 51 (78.5) |
χ2 (P value) | < 0.01 (1.00) | 0.15 (0.694) | 0.46 (0.498) | 0.1 (0.755) | 0.01 (0.915) | < 0.01(1.00) | |
Stage | |||||||
I | 29 (13.9) | 7 (58.3) | 7 (50.0) | 9 (50.0) | 12 (63.2) | 12 (66.7) | 17 (89.5) |
II | 77 (37.0) | 13 (48.1) | 17 (45.9) | 21 (56.8) | 33 (75.0) | 29 (78.4) | 39 (88.6) |
III | 68 (32.7) | 13 (65.0) | 21 (63.6) | 22 (68.8) | 31 (75.6) | 22 (68.8) | 27 (65.9) |
IV | 34 (16.3) | 4 (36.4) | 7 (35.0) | 14 (77.8) | 17 (85.0) | 13 (72.2) | 14 (70.0) |
χ2 (P value) | 2.77 (0.429) | 4.5 (0.212) | 4.06 (0.255) | 2.5 (0.476) | 1.17 (0.760) | 8.69a (0.034) | |
5-yr recurrence1 | |||||||
No | 141 (82.0) | 28 (51.9) | 35 (49.3) | 43 (56.6) | 61 (70.9) | 54 (71.1) | 71 (82.6) |
Yes | 31 (18.0) | 4 (40.0) | 9 (60.0) | 12 (80.0) | 14 (82.4) | 11 (73.3) | 12 (70.6) |
χ2 (P value) | 0.12 (0.731) | 0.22 (0.639) | 1.98 (0.160) | 0.45 (0.504) | < 0.01 (1.00) | 0.65 (0.421) | |
5-yr all-cause death | |||||||
No | 168 (80.8) | 29 (54.7) | 43 (51.8) | 50 (61.0) | 79 (78.2) | 59 (72.0) | 77 (76.2) |
Yes | 40 (19.2) | 8 (47.1) | 9 (42.9) | 16 (69.6) | 14 (60.9) | 17 (73.9) | 20 (87.0) |
χ2 (P value) | 0.07 (0.786) | 0.24 (0.625) | 0.26 (0.611) | 2.15 (0.142) | < 0.01 (1.00) | 0.71 (0.399) | |
5-yr progression | |||||||
No | 155 (74.5) | 28 (56.0) | 39 (50.0) | 45 (58.4) | 73 (76.8) | 56 (72.7) | 74 (77.9) |
Yes | 53 (25.5) | 9 (45.0) | 13 (50.0) | 21 (75.0) | 20 (69.0) | 20 (71.4) | 23 (79.3) |
χ2 (P value) | 0.32 (0.570) | < 0.01(1.00) | 1.75 (0.185) | 0.38 (0.540) | < 0.01 (1.00) | < 0.01 (1.00) | |
Lymphovascular invasion1 | |||||||
No | 106 (52.5) | 20 (48.8) | 25 (48.1) | 32 (56.1) | 46 (73.0) | 41 (71.9) | 55 (87.3) |
Yes | 96 (47.5) | 16 (57.1) | 27 (51.9) | 34 (72.3) | 47 (78.3) | 34 (72.3) | 41 (68.3) |
χ2 (P value) | 0.19 (0.662) | 0.04 (0.845) | 2.26 (0.133) | 0.23 (0.634) | < 0.01 (1.00) | 5.44a (0.02) | |
Histological grade1 | |||||||
Well or moderately | 156 (89.7) | 27 (48.2) | 35 (47.3) | 52 (64.2) | 67 (74.4) | 58 (71.6) | 67 (74.4) |
Poor or undifferentiated | 18 (10.3) | 6 (100.0) | 9 (64.3) | 7 (70.0) | 14 (82.4) | 9 (90.0) | 13 (76.5) |
χ2 (P value) | 3.94a (0.047) | 0.76 (0.382) | < 0.01 (0.99) | 0.15 (0.697) | 0.75 (0.387) | < 0.01 (1.00) | |
Lymph node counts1 | |||||||
0-11 | 34 (18.4) | 7 (63.6) | 7 (50.0) | 12 (80.0) | 15 (83.3) | 13 (86.7) | 16 (88.9) |
≥ 12 | 151 (81.6) | 29 (52.7) | 40 (50.0) | 50 (61.7) | 70 (73.7) | 58 (71.6) | 70 (73.7) |
χ2 (P value) | 0.07 (0.786) | < 0.01 (1.00) | 1.14 (0.287) | 0.33 (0.568) | 0.81 (0.368) | 1.18 (0.278) | |
Tumor location1 | |||||||
Colon | 147 (79.9) | 28 (50.0) | 38 (50.7) | 53 (67.9) | 62 (70.5) | 60 (76.9) | 68 (77.3) |
Rectum | 37 (20.1) | 8 (80.0) | 9 (47.4) | 9 (50.0) | 23 (92.0) | 11 (61.1) | 18 (72.0) |
χ2 (P value) | 1.99 (0.158) | < 0.01(1.00) | 1.35 (0.245) | 3.76 (0.052) | 1.17 (0.280) | 0.08 (0.780) | |
Adjuvant chemotherapy1 | |||||||
No | 54 (29.3) | 10 (58.8) | 12 (42.9) | 15 (55.6) | 25 (73.5) | 20 (74.1) | 29 (85.3) |
Yes | 130 (70.7) | 26 (53.1) | 35 (53.0) | 47 (68.1) | 60 (75.9) | 51 (73.9) | 57 (72.2) |
χ2 (P value) | 0.02 (0.898) | 0.46 (0.499) | 0.85 (0.358) | 0.01 (0.971) | < 0.01(1.00) | 1.59 (0.207) |
Table 3 Methylation level of sulfatase modifying factor 2 and ADAM metallopeptidase with thrombospondin type 1 motif 5 in normal tissue and tumor tissue (n= 208)
Normal | Tumor | P value | |||||
n1 | Median | mean ± SD2 | n1 | Median | mean ± SD2 | ||
SUMF2 | |||||||
CpG_1 | 69 | 0.40 | 0.43 ± 0.15 | 104 | 0.53 | 0.55 ± 0.17 | < 0.001 |
CpG_2 | 70 | 0.56 | 0.56 ± 0.11 | 104 | 0.76 | 0.73 ± 0.13 | < 0.001 |
CpG_3 | 70 | 0.38 | 0.39 ± 0.11 | 104 | 0.54 | 0.54 ± 0.17 | < 0.001 |
CpG_7 | 48 | 0.64 | 0.64 ± 0.15 | 80 | 0.87 | 0.81 ± 0.20 | 0.001 |
ADAMTS5 | |||||||
CpG_1 | 66 | 0.06 | 0.08 ± 0.07 | 95 | 0.19 | 0.25 ± 0.20 | < 0.001 |
CpG_2 | 70 | 0.06 | 0.08 ± 0.06 | 105 | 0.20 | 0.24 ± 0.18 | < 0.001 |
CpG_9 | 69 | 0.06 | 0.07 ± 0.06 | 91 | 0.21 | 0.25 ± 0.18 | < 0.001 |
CpG_10.11 | 69 | 0.08 | 0.10 ± 0.09 | 103 | 0.30 | 0.34 ± 0.22 | < 0.001 |
CpG_12 | 65 | 0.09 | 0.10 ± 0.08 | 98 | 0.19 | 0.24 ± 0.21 | 0.001 |
CpG_13 | 63 | 0.07 | 0.12 ± 0.14 | 94 | 0.15 | 0.22 ± 0.22 | 0.009 |
CpG_14.15 | 71 | 0.32 | 0.33 ± 0.05 | 105 | 0.43 | 0.44 ± 0.11 | < 0.001 |
CpG_16 | 71 | 0.10 | 0.11 ± 0.04 | 105 | 0.19 | 0.22 ± 0.12 | < 0.001 |
Table 4 Multivariate 5-year progression and survival analysis of SUMF2 and ADAMTS5 gene
RFS | PFS | OS | ||||
cHR (95%CI) | aHR (95%CI)1 | cHR (95%CI) | aHR (95%CI)1 | cHR (95%CI) | aHR (95%CI)2 | |
SUMF2 in tumor tissue | ||||||
CpG_3+CpG_7 | ||||||
Hypomethylation | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) |
Hypermethylation | 2.37 (0.86-6.55) | 1.64 (0.55-4.89) | 2.24 (1.03-4.85)a | 2.05 (0.91-4.62) | 2.56 (1.08-6.04)a | 3.53 (1.35-9.26)a |
ADAMTS5 in normal tissue | ||||||
CpG_2 | ||||||
Hypomethylation | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) |
Hypermethylation | 0.15 (0.03-0.71)a | 0.17 (0.03-0.95)a | 0.57 (0.24-1.37) | 0.54 (0.21-1.41) | 0.82 (0.31-2.16) | 0.94 (0.31-2.85) |
CpG_13 | ||||||
Hypomethylation | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) | 1.00 (Reference) |
Hypermethylation | 0.20 (0.04-0.97)a | 0.16 (0.03-0.85)a | 0.48 (0.19-1.19) | 0.45 (0.17-1.18) | 0.50 (0.19-1.30) | 0.72 (0.24-2.15) |
- Citation: Su JQ, Lai PY, Hu PH, Hu JM, Chang PK, Chen CY, Wu JJ, Lin YJ, Sun CA, Yang T, Hsu CH, Lin HC, Chou YC. Differential DNA methylation analysis of SUMF2, ADAMTS5, and PXDN provides novel insights into colorectal cancer prognosis prediction in Taiwan. World J Gastroenterol 2022; 28(8): 825-839
- URL: https://www.wjgnet.com/1007-9327/full/v28/i8/825.htm
- DOI: https://dx.doi.org/10.3748/wjg.v28.i8.825