Association between human leukocyte antigen gene polymorphisms and multiple EPIYA-C repeats in gastrointestinal disorders

doi:10.3748/wjg.v26.i32.4817

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 26, Issue 32

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (6855)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-2) series, Tables (1-8) series.

Item

Count

PDF

435

WORD

266

HTML

2495

Figures (1-2)

211

Tables (1-8)

174

Sum=3581

Featured Article

The chart showing Browse series, Download series.

Item

Count

Browse

336

Download

766

Sum=1102

Publishing Process of This Article

Item

Count

Browse

711

Download

1461

Sum=2172

Aug 28, 2020 (publication date) through May 5, 2024

Times Cited of This Article

Times Cited (6)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Case Control Study

World J Gastroenterol. Aug 28, 2020; 26(32): 4817-4832
Published online Aug 28, 2020. doi: 10.3748/wjg.v26.i32.4817

Table 1 PCR primers

Primer	Primer sequence (59R39)	Ref.
cagA-F	GATAACAGGCAAGCTTTTGAGG¹	[19,20]
cagA-R	CTGCAAAAGATTGTTTGGCAGA¹	[19,20]
cagA28F	TTCTCAAAGGAGCAATTGGC²	[21]
cagA-P1C	GTCCTGCTTTCTTTTTATTAACTTKAGC²
cagA-P2CG	TTTAGCAACTTGAGCGTAAATGGG²
cagA-P2TA	TTTAGCAACTTGAGTATAAATGGG²
cagA-P3E	ATCAATTGTAGCGTAAATGGG²
“cag empty PCR”	GCTTGCTTGTATTGGCCTTG / GCATGCACATTCCCTAAAGT³	[22]

All polymerase chain reactions (PCRs) were performed in a 50 μL final volume with 1.25 U Taq polymerase, 16 μL PCR buffer, 3 μL 2.5 mM MgCl₂ and 1 μL dNTP mix (10 mM each) with the described primers using the thermal profiles detailed.

¹: 95 ºC for 2 min initial denaturation, followed by 45 cycles of 30 s at 95 ºC, 45 s at 53 ºC and 45 s at 72 ºC, with a final elongation step performed for 5 min at 72 ºC.

²: 95 ºC for 2 min initial denaturation, followed by 50 cycles of 30 s at 95 ºC, 45 s at 57 ºC and 35 s at 72 ºC, with a final elongation step performed for 5 min at 72 ºC.

³: 95 ºC for 2 min initial denaturation, followed by 40 cycles of 30 s at 95 ºC, 30 s at 57 ºC, 20 s at 72 ºC, with a final elongation step performed for 5 min at 72 ºC. PCR: Polymerase chain reaction.

Table 2 Comparison of human leukocyte antigen alleles predisposing susceptibility and resistance to gastric cancer/duodenal ulcer in patient and control groups, n (%)

HLA alleles	*Patient groupGC + DU, H. pylori* (+) (n = 94, alleles = 198)**	*Control groupNUD + Asymptomatic, H. pylori* (+) (n = 86, alleles = 172)**	OR	95%CI		P value
HLA alleles			OR	Minimum	Maximum	P value
HLAs increasing susceptibility to GC/DU
HLA-A*02	52 (27.6)	38 (22)	1.34	0.833	2.182	0.2239
HLA-B*35	40 (21.3)	26 (15.1)	1.51	0.880	2.615	0.1329
HLA-DRB1*13	36 (19)	24 (14)	1.46	0.831	2.567	0.1880
HLA-DQA1*01	76 (40)	30 (17.4)	3.21	1.968	5.242	0.0001
HLA-DQB1*06	52 (27.6)	20 (11.6)	2.90	1.652	5.139	0.0002
HLAs making resistant to GC/DU
HLA-A*03	14 (7.4)	20 (11.6)	0.61	0.298	1.252	0.1787
HLA-B*50	0 (0)	10 (5.8)	0.08	0.010	0.680	0.0201
HLA-DRB1*04	16 (8.5)	24 (14)	0.57	0.293	1.120	0.1038
HLA-DQA1*05	28 (14.9)	54 (31.4)	0.38	0.228	0.639	0.0003
HLA-DQB1*03	42 (23)	64 (37.2)	0.48	0.305	0.770	0.0022

HLA: Human leukocyte antigen; H. pylori: Helicobacter pylori; GC: Gastric cancer; DU: Duodenal ulcer; NUD: Non-ulcer dyspepsia; CI: Confidence interval; OR: Odds ratio.

Table 3 The comparison of human leukocyte antigen alleles which increase or decrease the gastric cancer risk in gastric cancer subgroup cases in terms of CagA+ (≥ 2) EPIYA-C, n (%)

	GC (≥ 2) EPIYA-C (n = 26, alleles = 52)	GC (< 2) EPIYA-C (n = 18, alleles = 36)	OR	95%CI			P value
	GC (≥ 2) EPIYA-C (n = 26, alleles = 52)	GC (< 2) EPIYA-C (n = 18, alleles = 36)	OR	Minimum	Maximum		P value
HLA-A*02	12 (23)	10 (27)	0.78	0.29		2.06	0.6170
HLA-B*35	12 (23)	10 (27)	0.78	0.29		2.06	0.6170
HLA-DRB1*13	12 (23)	12 (33)	0.60	0.23		1.54	0.2903
HLA-DQA1*01	24 (46)	16 (44)	1.07	0.45		2.51	0.8742
HLA-DQB1*06	12 (23)	16 (44)	0.37	1.14		2.90	0.0369

HLA: Human leukocyte antigen; GC: Gastric cancer; CI: Confidence interval; OR: Odds ratio.

Table 4 The comparison of human leukocyte antigen alleles which increase or decrease the duodenal ulcer risk in duodenal ulcer subgroup in terms of CagA+(≥ 2) EPIYA-C, n (%)

	DU (≥ 2) EPIYA-C (n = 14, alleles = 28)	DU (< 2) EPIYA-C (n = 36, alleles = 72)	OR^c	95%CI			P value
	DU (≥ 2) EPIYA-C (n = 14, alleles = 28)	DU (< 2) EPIYA-C (n = 36, alleles = 72)	OR^c	Minimum	Maximum		P value
HLA-A*02	10 (36)	20 (27)	1.44	0.53		3.62	0.4380
HLA-B*35	4 (14)	14 (19)	0.80	0.24		0.680	0.0201
HLA-DRB1*13	6 (21)	6 (8)	3	0.87		10.26	0.0801
HLA-DQA1*01	10 (36)	26 (36)	0.9	0.39		2.44	0.9704
HLA-DQB1*06	8 (28)	16 (22)	1.4	0.52		3.75	0.5340

HLA: Human leukocyte antigen; DU: Duodenal ulcer; CI: Confidence interval; OR: Odds ratio.

Table 5 The comparison of human leukocyte antigen alleles which increase or decrease the gastric cancer/duodenal ulcer risk in gastric cancer and duodenal ulcer subgroups in terms of CagA+(≥ 2) EPIYA-C, n (%)

	GC(≥ 2) EPIYA-C (n = 26, alleles=52)	DU(≥ 2) EPIYA-C (n = 14, alleles=28)	OR	95%CI			P value
	GC(≥ 2) EPIYA-C (n = 26, alleles=52)	DU(≥ 2) EPIYA-C (n = 14, alleles=28)	OR	Minimum	Maximum		P value
HLA-A*02	12 (23)	10 (36)	0.54	0.19		1.47	0.2302
HLA-B*35	12 (23)	4 (14)	1.80	0.52		6.21	0.3527
HLA-DRB1*13	12 (23)	6 (21)	1.10	0.36		3.83	0.8663
HLA-DQA1*01	24 (46)	10 (36)	1.54	0.59		3.97	0.3689
HLA-DRB1*06	12 (23)	8 (28)	0.75	0.26		2.12	0.5889

HLA: Human leukocyte antigen; GC: Gastric cancer; DU: Duodenal ulcer; CI: Confidence interval; OR: Odds ratio.

Table 6 Results of logistic regressions analysis according to the variables in patient group (gastric cancer and duodenal ulcer cases)

	P value	OR	95%CI
	P value	OR	Lower	Upper
HLA-DQA1*01	0.004	1.848	1.215	2.811
HLA-DQA1*05	0.050
HLA-DQB1*03	0.061
HLA-DQB1*06	0.009	1.821	1.163	2.850
HLA-A*02	0.040	1.579	1.021	2.442
HLA-A*25	0.999

Variable(s) entered on step 1: QA1, QA5, QB3, QB6, A2, A25, B35. HLA: Human leukocyte antigen; CI: Confidence interval; OR: Odds ratio.

Table 7 Frequency of detected human leukocyte antigen class I alleles and the class II alleles in patients with cancer and ulcer and in the control groups, n (%)

*HLA-A*	Allele frequency		HLA-B	Allele frequency		HLA-DRB1	Allele frequency		HLA-DQA1	Allele frequency		HLA-DQB1	Allele frequency
Alleles	Cases (n = 94)	Control (n = 86)	Alleles	Cases (n = 94)	Control (n = 86)	Alleles	Cases (n = 94)	Control (n = 86)	Alleles	Cases (n = 94)	Control (n = 86)	Alleles	Cases (n = 94)	Control (n = 86)
01	22 (11.4)	24 (13.9)	07	18 (9.5)	22 (12.8)	01	14 (7.4)	8 (4.6)	01	76 (40)	30 (17.4)	02	20 (10.6)	26 (15.1)
02	52 (27.6)	38 (22)	08	6 (3.2)	6 (3.5)	03	10 (5.3)	10 (5.8)	02	20 (10.6)	20 (11.6)	03	42 (23)	64 (37.2)
03	14 (7.4)	20 (11.6)	13	6 (3.2)	4 (2.3)	04	16 (8.5)	22 (12.7)	03	12 (6.4)	22 (12.8)	04	26 (13.8)	28 (16.2)
11	18 (9.5)	18 (10.4)	14	6 (3.2)	4 (2.3)	07	10 (5.3)	20 (11.6)	04	16 (8.5)	20 (11.6)	05	48 (25.5)	34 (19.8)
23	10 (5.3)	4 (2.3)	15	2 (1)	6 (3.5)	08	4 (2.1)	6 (3.5)	05	28 (14.9)	54 (31.4)	06	52 (27.6)	20 (11.6)
24	26 (13.8)	24 (13.9)	18	10 (5.3)	10 (5.8)	10	6 (3.2)	4 (2.3)	06	36 (19.1)	26 (15.1)
25	0 (0)	2 (1.1)	27	6 (3.2)	4 (2.3)	11	34 (18)	42 (24.4)
26	4 (2.1)	4 (2.3)	35	40 (21.3)	26 (15.1)	12	6 (3.2)	2 (1.2)
29	8 (4.2)	8 (4.6)	37	4 (2.1)	0 (0)	13	36 (19)	24 (14)
30	4 (2.1)	6 (3.4)	38	8 (4.2)	2 (1.2)	14	18 (9.5)	8 (4.6)
31	2 (1)	4 (2.3)	39	0 (0)	4 (2.3)	15	28 (14.9)	22 (12.8)
32	16 (8.5)	10 (5.8)	40	6 (3.2)	6 (3.5)	16	6 (3.2)	4 (2.3)
33	6 (3.1)	4 (2.3)	41	4 (2.1)	2 (1.2)
68	4 (2.1)	6 (3.4)	44	8 (4.2)	14 (8.1)
69	2 (1)	0 (0)	45	0 (0)	2 (1.2)
			48	2 (1)	2 (1.2)
			49	6 (3.2)	4 (2.3)
			50	0 (0)	10 (5.8)
			51	24 (12)	30 (17.4)
			52	14 (7.4)	2 (1.2)
			53	0 (0)	2 (1.2)
			54	2 (1)	0 (0)
			55	6 (3.2)	8 (4.6)
			57	2 (1)	2 (1.2)
			58	8 (4.2)	0 (0)
			78	0 (0)	0 (0)

HLA: Human leukocyte antigen.

Table 8 The distribution of EPIYA motifs for study and control groups, n (%)

EPIYA-C repeat patterns	Patient group				Control group				Total (n = 140)
EPIYA-C repeat patterns	Gastric cancer		Duodenal ulcer		Non-ulcer dyspepsia		Individuals with normal gastrointestinal system		Total (n = 140)
ABC	12	(27.2)	34	(68)	28	(93.3)	16	(100)	90
AC	2	(4.5)	2	(4)	-		-		4
BC	2	(4.5)	-		-		-		2
ABCC	16	(36.4)	8	(16)	-		-		24
BCC	2	(4.6)	2	(4)	2	(6.7)	-		6
ACCC	-		-		-		-		-
ABCC	8	(18.2)	4	(8)	-		-		12
AB	2	(4.6)	-		-		-		2
Total	44	(100)	50	(100)	30	(100)	16	(100)	140

HLA: Human leukocyte antigen.

Citation: Saribas S, Demiryas S, Yilmaz E, Uysal O, Kepil N, Demirci M, Caliskan R, Dinc HO, Akkus S, Gareayaghi N, Kirmusaoglu S, Ozbey D, Tokman HB, Koksal SS, Tasci I, Kocazeybek B. Association between human leukocyte antigen gene polymorphisms and multiple EPIYA-C repeats in gastrointestinal disorders. World J Gastroenterol 2020; 26(32): 4817-4832
URL: https://www.wjgnet.com/1007-9327/full/v26/i32/4817.htm
DOI: https://dx.doi.org/10.3748/wjg.v26.i32.4817