Differential expression of mucin 1 and mucin 2 in colorectal cancer

Table 1 Primer sequences used for real-time quantitative polymerase chain reaction analysis

Transcript	Sequence (5’-3’ direction)	ENST number http://www.ensembl.org	Product size
MUC1	TCCAATATTAAGTTCAGGCCAGGA	00000185499.16	768 bp
	CACATCACTCACGCTGACGT
MUC2	TGAAGACCTGCGGCTGTGT	00000198788.8	3108 bp
	CAGTCGAACTCGAAGTGCTCC
β-actin	TCTGGCACCACACCTTCTAC	00000298556	169 bp
	GATAGCACAGCCTGGATAGC
GADPH	GAAGGTGAAGGTCGGAGTCA	00000229239	199 bp
	GACAAGCTTCCCGTTCTCAG
HRPT1	CTGAGGATTTGGAAAGGGTG	00000298556	156 bp
	AATCCAGCAGGTCAGCAAAC

Table 2 Clinicopathologic features of colorectal carcinoma patients n (%)

Variable		CRC (n = 34)
Age (yr)	< 50	2 (6)
	≥ 50	32 (94)
Sex	male	27 (79)
	female	7 (21)
Tumor location	Right colon	10 (29)
	Left colon	21 (62)
	Rectum	3 (9)
Mucin content	Nonmucinous	24 (71)
	Mucinous	10 (29)
Histologic grade (G)	Carcinoma in situ	1 (3)
	Well differentiated (G1)	1 (3)
	Moderately differentiated (G2)	23 (68)
	Poorly differentiated (G3)	9 (26)
Gross morphology	Protruded	21 (62)
	Flat	13 (38)
Dukes/Astler and Coller stage	Carcinoma in situ	1 (3)
	A/B1	4 (12)
	B/B2, B3	10 (29)
	C/C1, C2, C3	14 (41)
	D	5 (15)
TNM classification system	Carcinoma in situ	1 (3)
	I and II	4 (12)
	III and IV	29 (85)
Status	Survival	27 (79)
	Death	7 (21)

CRC: Colorectal carcinoma.

Table 3 Tissue expression of mRNA and proteins of both mucins, mucin 1/mucin 2 ratio in colorectal carcinoma and in unaltered colorectal tissue

		Group	Number	Mean	Median	Min	Max	SD	aP value
MUC1	mRNA	CRC	23	75095	49309	5648	267473	72149	0.004
		Control	23	32413	20075	2	199681	44486
	Protein	CRC	34	2.57	1.64	0.33	9.80	2.24	0.627
		Control	32	2.16	1.72	0.00	6.54	1.64
MUC2	mRNA	CRC	23	350227	191457	2806	2399156	529270	0.274
		Control	23	219744	130691	1	1509936	324252
	Protein	CRC	34	4.94	2.15	0.20	32.30	7.24	0.035
		Control	32	7.40	5.15	0.73	31.60	6.77
MUC1/MUC2 ratio	mRNA	CRC	23	1.56	0.25	0.06	21.30	4.50	0.128
		Control	23	0.28	0.18	0.04	2.00	0.40
	Protein	CRC	34	1.84	0.80	0.04	10.35	2.54	0.003
		Control	32	0.52	0.37	0.00	1.95	0.51

Control: Unaltered colorectal tissue;

^aP: Comparing colorectal carcinoma and control. MUC1: Mucin 1; MUC2: Mucin 2; SD: Standard deviation; CRC: Colorectal carcinoma.

Table 4 Values of Spearman’s coefficient for correlation between both mucins (mRNA, protein) and Ki-67 and/or p53 protein expressions in colorectal carcinoma samples

	MUC1	MUC2	mRNA MUC1	mRNA MUC2	Ki-67	p53
MUC1	-	0.046	0.405a	0.199	0.015	-0.106
MUC2	0.046	-	0.457	0.126	-0.4281	-0.3891
mRNA MUC1	0.405a	0.457	-	0.6021	-0.121	-0.215
mRNA MUC2	0.199	0.126	0.6021	-	0.033	-0.145
Ki-67	0.015	-0.4281	-0.121	0.033	-	0.6021
p53	-0.106	-0.3891	-0.215	-0.145	0.6021	-

¹Indicate values of r coefficient for which P < 0.05;

^aP = 0.055. MUC1: Mucin 1; MUC2: Mucin 2.

Table 5 Values of Spearman’s coefficient for correlation between mucins expression (mRNA/protein) in colorectal carcinoma and selected clinical data

	Age (yr)	Hemoglobin (g/dL)	WBC (× 109/L)	Thrombocytes (g/L)	Glucose (mg/dL)
MUC1	-0.322	-0.175	0.067	0.4741	-0.277
MUC2	0.053	-0.123	-0.097	-0.085	-0.346
mRNA MUC1	-0.4811	0.189	0.4651	0.203	-0.325
mRNA MUC2	-0.412	-0.098	0.4741	-0.145	-0.306

¹Indicate values of r coefficient for which P < 0.05. WBC: White blood cell; MUC1: Mucin 1; MUC2: Mucin 2.