Copyright
©The Author(s) 2018.
World J Gastroenterol. Sep 28, 2018; 24(36): 4164-4177
Published online Sep 28, 2018. doi: 10.3748/wjg.v24.i36.4164
Published online Sep 28, 2018. doi: 10.3748/wjg.v24.i36.4164
Table 1 Primer sequences used for real-time quantitative polymerase chain reaction analysis
Transcript | Sequence (5’-3’ direction) | ENST number http://www.ensembl.org | Product size |
MUC1 | TCCAATATTAAGTTCAGGCCAGGA | 00000185499.16 | 768 bp |
CACATCACTCACGCTGACGT | |||
MUC2 | TGAAGACCTGCGGCTGTGT | 00000198788.8 | 3108 bp |
CAGTCGAACTCGAAGTGCTCC | |||
β-actin | TCTGGCACCACACCTTCTAC | 00000298556 | 169 bp |
GATAGCACAGCCTGGATAGC | |||
GADPH | GAAGGTGAAGGTCGGAGTCA | 00000229239 | 199 bp |
GACAAGCTTCCCGTTCTCAG | |||
HRPT1 | CTGAGGATTTGGAAAGGGTG | 00000298556 | 156 bp |
AATCCAGCAGGTCAGCAAAC |
Table 2 Clinicopathologic features of colorectal carcinoma patients n (%)
Variable | CRC (n = 34) | |
Age (yr) | < 50 | 2 (6) |
≥ 50 | 32 (94) | |
Sex | male | 27 (79) |
female | 7 (21) | |
Tumor location | Right colon | 10 (29) |
Left colon | 21 (62) | |
Rectum | 3 (9) | |
Mucin content | Nonmucinous | 24 (71) |
Mucinous | 10 (29) | |
Histologic grade (G) | Carcinoma in situ | 1 (3) |
Well differentiated (G1) | 1 (3) | |
Moderately differentiated (G2) | 23 (68) | |
Poorly differentiated (G3) | 9 (26) | |
Gross morphology | Protruded | 21 (62) |
Flat | 13 (38) | |
Dukes/Astler and Coller stage | Carcinoma in situ | 1 (3) |
A/B1 | 4 (12) | |
B/B2, B3 | 10 (29) | |
C/C1, C2, C3 | 14 (41) | |
D | 5 (15) | |
TNM classification system | Carcinoma in situ | 1 (3) |
I and II | 4 (12) | |
III and IV | 29 (85) | |
Status | Survival | 27 (79) |
Death | 7 (21) |
Table 3 Tissue expression of mRNA and proteins of both mucins, mucin 1/mucin 2 ratio in colorectal carcinoma and in unaltered colorectal tissue
Group | Number | Mean | Median | Min | Max | SD | aP value | ||
MUC1 | mRNA | CRC | 23 | 75095 | 49309 | 5648 | 267473 | 72149 | 0.004 |
Control | 23 | 32413 | 20075 | 2 | 199681 | 44486 | |||
Protein | CRC | 34 | 2.57 | 1.64 | 0.33 | 9.80 | 2.24 | 0.627 | |
Control | 32 | 2.16 | 1.72 | 0.00 | 6.54 | 1.64 | |||
MUC2 | mRNA | CRC | 23 | 350227 | 191457 | 2806 | 2399156 | 529270 | 0.274 |
Control | 23 | 219744 | 130691 | 1 | 1509936 | 324252 | |||
Protein | CRC | 34 | 4.94 | 2.15 | 0.20 | 32.30 | 7.24 | 0.035 | |
Control | 32 | 7.40 | 5.15 | 0.73 | 31.60 | 6.77 | |||
MUC1/MUC2 ratio | mRNA | CRC | 23 | 1.56 | 0.25 | 0.06 | 21.30 | 4.50 | 0.128 |
Control | 23 | 0.28 | 0.18 | 0.04 | 2.00 | 0.40 | |||
Protein | CRC | 34 | 1.84 | 0.80 | 0.04 | 10.35 | 2.54 | 0.003 | |
Control | 32 | 0.52 | 0.37 | 0.00 | 1.95 | 0.51 |
Table 4 Values of Spearman’s coefficient for correlation between both mucins (mRNA, protein) and Ki-67 and/or p53 protein expressions in colorectal carcinoma samples
Table 5 Values of Spearman’s coefficient for correlation between mucins expression (mRNA/protein) in colorectal carcinoma and selected clinical data
- Citation: Kasprzak A, Siodła E, Andrzejewska M, Szmeja J, Seraszek-Jaros A, Cofta S, Szaflarski W. Differential expression of mucin 1 and mucin 2 in colorectal cancer. World J Gastroenterol 2018; 24(36): 4164-4177
- URL: https://www.wjgnet.com/1007-9327/full/v24/i36/4164.htm
- DOI: https://dx.doi.org/10.3748/wjg.v24.i36.4164