Copyright
©The Author(s) 2017.
World J Gastroenterol. Sep 14, 2017; 23(34): 6330-6338
Published online Sep 14, 2017. doi: 10.3748/wjg.v23.i34.6330
Published online Sep 14, 2017. doi: 10.3748/wjg.v23.i34.6330
Table 1 The three differently expressed circRNAs in human gastric cancer and colorectal cancer samples
CircRNA | Chrom | TxStart | TxEnd | circBaseID | Best_transcript | Gene name | Catalog |
Chr16: 30740287-30740893|+ | 16 | 30740286 | 30740893 | 266 | NM_006662 | SRCAP | Exonic |
Hsa_circ_0000745 | 17 | 20107645 | 20109225 | 790 | NM_152904 | SPECC1 | Exonic |
Hsa_circ_0085616 | 8 | 131370262 | 131374017 | 127 | NM_001247996 | ASAP1 | Exonic |
Table 2 Primers used for quantitative reverse transcription-polymerase chain reaction analysis of circular RNA and mRNA levels
Target ID | Primer sequence, 5’-3’ | Product size in bp |
Circ_0000745 | F: GTTGAAAGTAGCCCGAGCAG | 204 |
R: ACGTGGCACAGACCTCTCTC | ||
Circ_0085616 | F: GACTACAACTCGCCCACCAC | 200 |
R: TCCATTTCTGGGCCATAATC | ||
Chr16:30740286-30740893|+ | F: CCTTTGCACCGTATTGTGTG | 199 |
R: GGCAGGGTACAGAAATCCAG | ||
GAPDH | F: CTCGCTTCGGCAGCACA | 122 |
R: AACGCTTCACGAATTTGCGT |
Table 3 Relationship of hsa_circ_0000190 expression levels (2-ΔΔCt) in gastric cancer tissues with clinicopathological factors of patients with gastric cancer
Clinicopathological factor | Tissue hsa_circ_0000745 | Plasma hsa_circ_0000745 | |||
n | Mean ± SD | P value | mean ± SD | P value | |
Age (yr) | 0.757 | 0.195 | |||
< 60 | 33 | 0.77 ± 0.83 | 0.90 ± 0.96 | ||
≥ 60 | 27 | 0.58 ± 0.60 | 0.69 ± 0.53 | ||
Sex | 0.203 | 0.252 | |||
Male | 43 | 0.59 ± 0.67 | 0.68 ± 0.60 | ||
Female | 17 | 0.92 ± 0.85 | 1.13 ± 1.12 | ||
Diameter in cm | 0.168 | 0.127 | |||
≥ 5 | 26 | 0.76 ± 0.77 | 0.87 ± 0.76 | ||
< 5 | 34 | 0.63 ± 0.71 | 0.76 ± 0.84 | ||
Differentiation | 0.012a | 0.087 | |||
Well | 2 | 0.96 ± 1.10 | 0.89 ± 0.44 | ||
Moderate | 25 | 0.65 ± 0.71 | 0.70 ± 0.66 | ||
Poor | 33 | 0.70 ± 0.77 | 0.88 ± 0.92 | ||
Lymphatic metastasis | 0.064 | 0.087 | |||
Present | 44 | 0.71 ± 0.71 | 0.85 ± 0.78 | ||
Absent | 16 | 0.61 ± 0.81 | 0.69 ± 0.88 | ||
TNM stage | 0.056 | 0.046a | |||
I-II | 14 | 0.63 ± 0.81 | 0.60 ± 0.53 | ||
III-IV | 46 | 0.70 ± 0.72 | 0.87 ± 0.87 | ||
CEA in ng/mL | 0.077 | 0.130 | |||
≥ 5 | 10 | 0.79 ± 0.72 | 0.65 ± 0.59 | ||
< 5 | 50 | 0.66 ± 0.74 | 0.85 ± 0.78 |
- Citation: Huang M, He YR, Liang LC, Huang Q, Zhu ZQ. Circular RNA hsa_circ_0000745 may serve as a diagnostic marker for gastric cancer. World J Gastroenterol 2017; 23(34): 6330-6338
- URL: https://www.wjgnet.com/1007-9327/full/v23/i34/6330.htm
- DOI: https://dx.doi.org/10.3748/wjg.v23.i34.6330