KRAS and BRAF gene mutations and DNA mismatch repair status in Chinese colorectal carcinoma patients

Table 1 Primary antibodies for immunohistochemical staining for mismatch repair proteins

Antibody	Supplied by	Clone No.	Positive signal localization	Dilution	Incubation temperature (°C)	Incubationperiod (h)
MLH1	Novocastra, UK	14	Nuclear	1:50	37	2
MSH2	Novocastra, UK	FE11	Nuclear	1:20	37	2
MSH6	Novocastra, UK	BC/44	Nuclear	1:80	37	2
PSM2	Novocastra, UK	EP51	Nuclear	1:30	37	2

Table 2 Primer sequences for KRAS exon 2 and BRAF exons 15, annealing temperature and size of expected PCR products

Exon	Primer No.	Primer sequence 5’-3’	AT (°C)	Product size (bp)
KRAS 2	2-F	TAGTCACATTTTCATTATTTTTAT	55	160
	2-R	AGATTTACCTCTATTGTTGGAT
BRAF 15	15-F	ATCTACTGTTTTCCTTTACTTACT	55	160
	15-R	ATTCTTACCATCCACAAAATG

AT: Annealing temperature; F: Forward; R: Reverse.

Table 3 Clinicopathological information of the studied patients n (%)

Clinical feature		Total cases
Gender	Male	306 (57.2)
	Female	229 (42.8)
Age (yr)	< 50	57 (10.7)
	≥ 50	478 (89.3)
Location	Right colon	177 (32.9)
	Left colon	165 (30.7)
	Rectum	196 (36.4)
Tumor differentiation	Poor	94 (17.5)
	Well-moderate	444 (82.5)
Tumor stage	I	95 (17.7)
	II	168 (31.2)
	III	215 (40.0)
	IV	50 (9.3)
	Not available	10 (1.9)

Table 4 Correlations between KRAS and BRAF status and clinicopathological features n (%)

Clinicopathological feature	KRAS		BRAF
	Mutant/tested cases	P value	Mutant/tested cases	P value
Gender
Male	100/277 (36.1)	0.336	7/254 (2.8)	0.048
Female	84/208 (40.4)		13/196 (6.6)
Age (yr)
< 50	11/50 (22)	0.014	3/47 (6.4)	0.758
≥ 50	173/435 (39.8)		17/403 (4.2)
Location
Right colon	67/161 (41.6)	0.318	14/146 (9.6)	0.001
Left colon	50/150 (33.3)		3/167 (2.1)
Rectum	68/177 (38.4)		3/140 (1.8)
Mucin production
With	41/108 (38)	0.990	10/102 (9.8)	0.006
Without	144/380 (37.9)		10/351 (2.8)
Tumor differentiation
Poor	25/84 (29.8)	0.091	7/74 (9.5)	0.045
Well-moderate	160/404 (39.6)		13/379 (3.4)
Tumor stage
I-II	85/232 (36.6)	0.553	10/218 (4.6)	0.918
III-IV	97/247 (39.3)		10/228 (4.4)

Table 5 Correlations between DNA mismatch repair protein deficiency and clinicopathological features n (%)

Clinicopathological feature		dMMR		MLH1/PMS2		MSH2/MSH6
		Defective/tested	P value	Defective/tested	P value	Defective/tested	P value
Total		55/481 (11.4)		31/481 (6.4)		24/481 (5.0)
Gender	Male	25/272 (9.2)	0.095	12/272 (4.4)	0.034	13/272 (4.8)	0.970
	Female	29/206 (14.1)		19/206 (9.2)		10/206 (4.9)
Age (yr)	< 50	9/50 (18.0)	0.114	3/50 (6.0))	1.000	6/50 (12.0)	0.031
	≥ 50	45/428 (10.5)		28/428 (6.5)		17/428 (4.0)
Location	Right colon	33/161 (20.5)	0.000	23/161 (14.3)	0.000	10/161 (6.2)	0.446
	Left colon	13/142 (9.2)		5/142 (3.5)		8/142 (5.6)
	Rectum	9/178 (5.1)		3/178 (1.7)		6/178 (3.4)
Mucin production	With	20/99 (20.2)	0.002	11/99 (11.1)	0.034	9/99 (9.1)	0.065
	Without	35/382 (9.2)		20/382 (5.2)		15/382 (3.9)
Tumor differentiation	Poor	13/79 (16.5)	0.125	6/79 (7.6)	0.649	7/79 (8.9)	0.148
	Well-moderate	42/402 (10.4)		25/402 (6.2)		17/402 (4.2)
Tumor stage	I-II	37/246 (15.0)	0.012	20/246 (8.1)	0.127	17/246 (6.9)	0.049
	III-IV	18/234 (7.7)		11/234 (4.7)		7/234 (3.0)

Table 6 Correlations between DNA mismatch repair protein expression deficiency and KRAS or BRAF status n (%)

MMR status	KRAS (n = 432)		BRAF (n = 424)
	Mutant/tested cases	P value	Mutant/tested cases	P value
dMMR	9/48 (18.8)	0.0021	4/43 (9.3)	0.264
MLH1/PMS2 deficiency	3/29 (10.3)	0.0012	4/26 (15.4)	0.0373
MSH2/MSH6 deficiency	6/19 (31.6)	0.3833	0/17 (0)	0.8173
pMMR	160/384 (41.7)		16/381 (4.2)

¹dMMR vs pMMR;

²MLH1/PMS2 deficiency vs pMMR;

³MSH2/MSH6 vs pMMR. MMR: DNA mismatch repair.