High expression of CD11c indicates favorable prognosis in patients with gastric cancer

Table 1 Primer sequences used in this study

Gene	Forward primer sequence (5'→3')	Reverse primer sequence (5'→3')
CD11c	GGGATGCCGCCAAAATTCTC	ATTGCATAGCGGATGATGCCT
GAPDH	GGAAGGTGAAGGTCGGAGTC	CGTTCTCAGCCTTGACGGT

Table 2 Baseline characteristics of the low and high CD11c expression groups (n = 140)

Clinicopathological characteristics	All		CD11c expression				P value
			Low		High
	No.	%	No.	%	No.	%
Gender							0.113
Male	107	76.43	80	73.39	27	87.10
Female	33	23.57	29	26.61	4	12.90
Age (yr)							0.162
About 45	12	8.57	9	8.26	3	9.68
About 60	66	47.14	56	51.38	10	32.26
> 60	62	44.29	44	40.37	18	58.06
Tumor location
Gastric cardia							0.342
No	87	62.14	70	64.22	17	54.84
Yes	53	37.86	39	35.78	14	45.16
Tumor size (cm)1							< 0.001
< 5	56	47.46	36	38.71	20	80.00
≥ 5	62	52.54	57	61.29	5	20.00
Histological type2							0.042
Differentiated	54	40.60	37	35.92	17	56.67
Poorly differentiated	79	59.40	66	64.08	13	43.33
Invasion to muscular layer3							0.004
No	14	11.57	7	7.29	7	28.00
Yes	107	88.43	89	92.71	18	72.00
Nodal metastasis4							0.001
No	33	27.27	19	20.00	14	53.85
Yes	88	72.73	76	80.00	12	46.15
Pathological grade							0.047
1-2	17	12.14	13	11.93	4	12.90
3	70	50.00	49	44.95	21	67.74
4	53	37.86	47	43.12	6	19.35
UICC stage							0.002
I	11	7.86	4	3.67	7	22.58
II	27	19.29	22	20.18	5	16.13
III	88	62.86	69	63.30	19	61.29
IV	14	10.00	14	12.84	0	0.00
Endpoint: DFS							0.038
No recurrence	20	14.29	12	11.01	8	25.81
Recurrence	120	85.71	97	88.99	23	74.19
Endpoint: OS							0.404
Survival	37	26.43	27	24.77	10	32.26
Died	103	73.57	82	75.23	21	67.74

¹Missing 22 cases;

²Missing 7 cases;

³Missing 19 cases;

⁴Missing 19 cases.

Table 3 Three- and 5-year overall survival and disease-free survival probability and median survival time (mo) in the low and high CD11c expression groups

Expression level of CD11c	3-yr OS (95%CI)	5-yr OS (95%CI)	Median survival time (95%CI)1	3-yr DFS (95%CI)	5-yr DFS (95%CI)	Median disease free time (95%CI)2
Low	39.2 (30.0-48.4)	29.0 (20.2-37.8)	28.0 (15.1-40.9)	24.0 (19.8-28.2)	11.9 (8.7-15.1)	18.0 (14.6-21.4)
High	67.7 (59.3-76.1)	51.4 (42.4-60.4)	67.0 (53.9-80.1)	63.7 (54.9-72.5)	49.1 (39.8-58.4)	64.0 (42.0-86.0)

¹Survival curve comparison, χ² = 6.801, P = 0.009;

²Disease-free curve comparison, χ² = 15.387, P < 0.001. OS: Overall survival; DFS: Disease-free survival.

Table 4 Multivariate Cox model analysis of the association between CD11c expression and the risk of death and relapse n (%)

Clinicopathological parameters	Number	OS			DFS
		HR	95%CI	P value	HR	95%CI	P value
CD11C expression
Low	109 (77.86)	1.00 (ref)			1.00 (ref)
High	31 (22.14)	0.56	0.33-0.98	0.041	0.39	0.23-0.67	0.001
Gender
Male	107 (76.43)	1.00 (ref)			1.00 (ref)
Female	33 (23.57)	1.08	0.64-1.83	0.769	0.77	0.46-1.27	0.306
Age groups
About 45	12 (8.57)	1.00 (ref)			1.00 (ref)
About 60	66 (47.14)	0.52	0.25-1.08	0.080	0.51	0.26-1.03	0.060
> 60	62 (44.29)	0.82	0.39-1.73	0.608	0.70	0.35-1.41	0.316
Gastric cardia
No	87 (62.14)	1.00 (ref)			1.00 (ref)
Yes	53 (37.86)	1.58	1.02-2.43	0.039	1.42	0.95-2.11	0.085
Histological type%
Differentiated	54 (40.60)	1.00 (ref)			1.00 (ref)
Poorly differentiated	79 (59.40)	1.26	0.79-2.02	0.333	1.025	0.68-1.56	0.907
Pathological grade
1-2	17 (12.14)	1.00 (ref)			1.00 (ref)
3	70 (50.00)	0.79	0.35-1.76	0.564	0.85	0.41-1.75	0.659
4	53 (37.86)	1.08	0.47-2.48	0.849	1.32	0.63-2.79	0.466
UICC stage
I	11 (7.86)	1.00 (ref)			1.00 (ref)
II	27 (19.20)	2.90	0.74-11.32	0.126	1.99	0.65-6.10	0.230
III	88 (62.86)	3.36	0.91-12.39	0.069	2.12	0.74-6.10	0.162
IV	14 (10.00)	9.94	2.46-40.19	0.001	9.20	2.75-30.78	< 0.001

OS: Overall survival; DFS: Disease-free survival.

Table 5 Comparison of HRs and association between CD11c expression and the risk of death and relapse in different Cox models

Cox models	CD11c expression	HR	95%CI	P value
OS
Model 11	Low	1.00 (ref)
	High	0.56	0.33-0.98	0.041
Model 22	Low	1.00 (ref)
	High	0.90	0.49-1.67	0.749
DFS
Model 31	Low	1.00 (ref)
	High	0.39	0.23-0.67	0.001
Model 42	Low	1.00 (ref)
	High	0.65	0.36-1.19	0.160

¹Adjusted for gender, age, tumor location, histological type, pathological grade and UICC stage;

²Adjusted for gender, age, tumor location, tumor size, histological type, pathological grade and UICC stage. OS: Overall survival; DFS: Disease-free survival.