TLR2 and TLR4 polymorphisms influence mRNA and protein expression in colorectal cancer

Table 1 Characteristics of patients with colorectal cancer and controls n (%)

Variables	CRC	Controls	OR (95%CI)	P value
Individuals, n	194	240
Age (yr)			0.4513 (0.3063-0.6649)
< 60	72 (37.1)	136 (56.7)		< 0.0001
≥ 60	122 (62.9)	104 (43.3)
mean ± SD	62 ± 12	56 ± 18
Variation	24 to 88	20 to 93
Gender			0.8619 (0.5898-1.259)	0.4988
Female	89 (45.9)	119 (49.6)
Male	105 (54.1)	121 (50.4)
Smoking habit			1.910 (1.299-2.808)	0.0013
Non-smokers	101 (52.1)	87 (36.3)
Smokers	93 (47.9)	153 (63.7)
Alcoholic habit			0.4963 (0.3305-0.7454)	0.0010
Non-alcoholic	114 (58.8)	178 (74.1)
Alcoholics	80 (41.2)	62 (25.9)

CRC: Colorectal cancer; OR: Odds ratio.

Table 2 Polymerase chain reaction-restriction fragment length polymorphism conditions, primers sequences, restriction enzyme and fragment sizes

Polymorphisms	Primers (5’-3’)	Enzymes	Fragment (bp)	Ref.
		T°/time
TLR2-196 to -174del	F: CACGGAGGCAGCGAGAAA	-	ins: 286	[59]
	R: CTGGGCCGTGCAAAGAAG		del: 264
TLR4 +896A/G	F: AGCATACTTAGACTACCACCTCGATG	BstXI	A: 131	[60]
(rs4986790)	R: GTTGCCATCCGAAATTATAAGAAAAG	37 °C/3 h	G: 108; 23
TLR4 -1607T/C	F: TTTGTATAATTTGACTACCATTGCGT	HhaI 37 °C/3 h	T: 139	[30]
(rs10759932)	R: CATTTTTTCACATCTTCACCAGC		C: 117; 22

ins: Wild-type allele (insertion); del: Polymorphic allele (deletion); bp: Base pairs; T^o: Temperature; F: Forward; R: Reverse.

Table 3 Allele and genotype frequencies of TLR2 and TLR4 polymorphisms and multiple logistic regression analysis between case and control groups n (%)

Polymorphisms	Statistical Models	Genotypes /alleles	C	CRC	P value
TLR2-196 to -174del			n = 240	n = 188
		ins/ins	200 (83.0)	144 (77.0)
		ins/del	36 (15.0)	39 (21.0)
		del/del	4 (2.0)	5 (3.0)
		ins	436 (0.9)	327 (0.9)
		del	44 (0.1)	49 (0.1)
	Dominant	ins/ins	200 (83.3)	144 (76.9)	0.038
		ins/del + del/del	40 (16.7)	44 (23.1)
	OR (95%CI)		1.72(1.03-2.89)
	Recessive	ins/ins + ins/del	236 (98.3)	183 (97.3)	0.360
		del/del	4 (1.7)	5 (2.7)
	OR (95%CI)		1.90 (0.48-7.58)
	Log-additive	ins/ins	200 (83.0)	144 (77.0)	0.039
		ins/del	36 (15.0)	39 (21.0)
		del/del	4 (2.0)	5 (3.0)
	OR (95%CI)		1.59 (1.02-2.48)
TLR4 -1607T/C			n = 208	n = 190
		T/T	166 (79.0)	154 (81.0)
		T/C	39 (19.0)	33 (17.0)
		C/C	3 (2.0)	3 (2.0)
		T	371 (0.9)	341 (0.9)
		C	45 (0.1)	39 (0.1)
	Dominant	T/T	166 (79.0)	154 (81.0)	0.860
		T/C + C/C	42 (21.0)	36 (19.0)
	OR (95%CI)		0.95 (0.56-1.63)
	Recessive	T/T + T/C	205 (98.0)	187 (98.0)	0.940
		C/C	3 (2.0)	3 (2.0)
	OR (95%CI)		0.93 (0.14-5.95)
	Log-additive	T/T	166 (79.0)	154 (81.0)	0.860
		T/C	39 (19.0)	33 (17.0)
		C/C	3 (2.0)	3 (2.0)
	OR (95%CI)		0.96 (0.59-1.55)
TLR4 +896A/G			n = 240	n = 190
	Dominant	A/A	224 (93.3)	172 (90.5)	0.520
		A/G	16 (6.7)	18 (9.5)
	OR (95%CI)		1.28 (0.60-2.73)
		A	464 (0.97)	349 (0.95)
		G	16 (0.03)	17 (0.05)

The data are adjusted for age, gender, smoking and drinking status. CRC: Colorectal cancer; C: Controls; OR: Odds ratio.

Table 4 Combined effect of polymorphisms TLR2 -196 to -174 del, TLR4 +896 A/G and TLR4 -1607 T/C on the risk of colorectal carcinoma

Risk genotypes	C	CRC	OR (95%CI)	P value
	n = 240	n = 188
None	104	136	1.00 (reference)
TLR2 ins/del or del/del TLR4 +896 A/G	4	3	0.98 (0.21-4.48)	1.000
TLR2 ins/del or del/del TLR4 -1607 T/C or C/C	11	11	1.31 (0.54-3.13)	0.650
TLR4 +896 A/G/	2	2	1.31 (0.18-9.44)	1.000
TLR4 -1607 T/C or C/C

CRC: Colorectal cancer; C: Controls; OR: Odds ratio.

Table 5 Haplotype frequency distribution of variants -1607 T/C and +896 A/G of TLR4 gene in the case and control groups

Haplotypes1	C	CRC	χ²	P value
TLR4 -1607/+896
T-A	0.861	0.849	0.207	0.649
C-A	0.108	0.103	0.052	0.819
T-G	0.031	0.048	1.414	0.234

¹C-G haplotype was not found. CRC: Colorectal cancer; C: Controls.

Table 6 TLR2 and TLR4 mRNA relative quantification values in colorectal carcinoma, stratified according to wild and polymorphic genotype

	TLR2 -196 to -174 del		TLR4 -1607 T/C
	ins/ins	ins/del2	T/T	T/C + C/C
n (%)1	27 (73.0)	10 (27.0)	31 (83.8)	6 (16.2)
Median	3.57	6.95	0.75	0.86
Range	0.49-13.59	0.62-14.69	0.20-23.89	0.47-2.27
P value3	0.035		1.000

¹3 tumor tissue samples which were not genotyped were excluded from the analysis; ²No individuals with a del/del genotype in tumor tissue samples were found;

³Results of the nonparametric Mann-Whitney U test. ins: Wild-type allele (insertion); del: Polymorphic allele (deletion).