Copyright
©2014 Baishideng Publishing Group Inc.
World J Gastroenterol. Sep 21, 2014; 20(35): 12542-12550
Published online Sep 21, 2014. doi: 10.3748/wjg.v20.i35.12542
Published online Sep 21, 2014. doi: 10.3748/wjg.v20.i35.12542
Table 1 Primers used for nested reverse transcriptase polymerase chain reaction amplification of cholecystokinin-B receptor, extracellular signal-regulated protein kinase 1/2 and K-ras
Name | Primer sequence | PCR conditions | Size (bp) |
CCK-BR | 1: 5’TCTCGCGAGCTCTACTTAGGG3’ | 94 °C, 30 s | 185 |
2: 5’ACCGACGATGCACGTTGAAG3’ | 62 °C, 30 s | ||
72 °C, 30 s | |||
ERK1/2 | 1: 5’TATTCCCGGGCAAGCACTATTT3’ | 94 °C, 30 s | 243 |
2: 5’CGGGCTCATCATTCGGGTCGTA3’ | 54 °C, 30 s | ||
72 °C, 30 s | |||
K-ras | 1: 5’ACAGTGCAATGAGGGACCAGTA3’ | 94 °C, 30 s | 275 |
2: 5’GTATAGAAGGCATCATCAACACC3’ | 50 °C, 30 s | ||
72 °C, 30 s | |||
Actin | 1: 5’ATGATATCGCCGCGCTCGTCGTC3’ | 94 °C, 30 s | 342 |
2: 5’CGCGGTTGGCCTTGGGGTTCAG3’ | 60 °C, 30 s | ||
72 °C, 30 s |
Table 2 Effect of different pentagastrin and proglumide concentrations on the proliferation of HT-29 cells (mean ± SD)
Table 3 Effect of combined pentagastrin and proglumide on the proliferation of HT-29 cells (mean ± SD)
Table 4 Comparison of proliferation index and apoptotic rates between the experimental groups and control group (mean ± SD)
Table 5 Comparison of protein, mRNA and phosphorylation levels of extracellular signal-regulated protein kinase 1/2 and K-ras between the experimental groups (mean ± SD) and control group
Group | n | ERK1/2 | K-ras | ||||
mRNA | Protein | p-ERK1/2 | mRNA | Protein | p-K-ras | ||
Control group | 5 | 0.76 ± 0.04 | 0.56 ± 0.05 | 0.32 ± 0.02 | 0.54 ± 0.08 | 0.56 ± 0.04 | 0.31 ± 0.05 |
Pentagastrin group | 5 | 0.79 ± 0.05 | 0.60 ± 0.04 | 0.43 ± 0.04a | 0.59 ± 0.06 | 0.57 ± 0.04 | 0.45 ± 0.06a |
Proglumide group | 5 | 0.74 ± 0.06 | 0.55 ± 0.07 | 0.31 ± 0.02c | 0.53 ± 0.05 | 0.55 ± 0.04 | 0.27 ± 0.06c |
Pentagastrin + proglumide group | 5 | 0.77 ± 0.05 | 0.58 ± 0.05 | 0.36 ± 0.01c | 0.55 ± 0.06 | 0.57 ± 0.04 | 0.35 ± 0.04c |
- Citation: Mao JD, Wu P, Huang JX, Wu J, Yang G. Role of ERK-MAPK signaling pathway in pentagastrin-regulated growth of large intestinal carcinoma. World J Gastroenterol 2014; 20(35): 12542-12550
- URL: https://www.wjgnet.com/1007-9327/full/v20/i35/12542.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i35.12542